Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCACCGTGGTCTAGATTCCCCCAA[A/C]CCCTGCCCCGGCAGTCTCTGTGCGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605518 MIM: 605538 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC100506405 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
LOC100506405 - uncharacterized LOC100506405 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LPIN1 - lipin 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001261427.1 | Intron | NP_001248356.1 | ||||
NM_001261428.1 | Intron | NP_001248357.1 | ||||
NM_001261429.1 | Intron | NP_001248358.1 | ||||
NM_145693.2 | Intron | NP_663731.1 | ||||
XM_006711869.2 | Intron | XP_006711932.1 | ||||
XM_006711870.3 | Intron | XP_006711933.1 | ||||
XM_006711871.2 | Intron | XP_006711934.1 | ||||
XM_006711872.2 | Intron | XP_006711935.1 | ||||
XM_006711874.2 | Intron | XP_006711937.1 | ||||
XM_011510333.2 | Intron | XP_011508635.1 | ||||
XM_011510334.2 | Intron | XP_011508636.1 | ||||
XM_011510335.2 | Intron | XP_011508637.1 | ||||
XM_011510336.2 | Intron | XP_011508638.1 | ||||
XM_017003623.1 | Intron | XP_016859112.1 | ||||
XM_017003624.1 | Intron | XP_016859113.1 | ||||
XM_017003625.1 | Intron | XP_016859114.1 | ||||
XM_017003626.1 | Intron | XP_016859115.1 | ||||
XM_017003627.1 | Intron | XP_016859116.1 | ||||
XM_017003628.1 | Intron | XP_016859117.1 | ||||
XM_017003629.1 | Intron | XP_016859118.1 | ||||
XM_017003630.1 | Intron | XP_016859119.1 | ||||
XM_017003631.1 | Intron | XP_016859120.1 | ||||
XM_017003632.1 | Intron | XP_016859121.1 |
NTSR2 - neurotensin receptor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |