Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGAACAAAGGTCCTGAGATGCAA[A/G]TAAGTGCTTATTTGGATATGCTTAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611406 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DYNC1LI2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DYNC1LI2 - dynein cytoplasmic 1 light intermediate chain 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC106699570 - uncharacterized LOC106699570 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TERB1 - telomere repeat binding bouquet formation protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136505.1 | Intron | NP_001129977.1 | ||||
XM_011523004.2 | Intron | XP_011521306.1 | ||||
XM_011523005.2 | Intron | XP_011521307.1 | ||||
XM_011523006.2 | Intron | XP_011521308.1 | ||||
XM_011523007.2 | Intron | XP_011521309.1 | ||||
XM_011523008.2 | Intron | XP_011521310.1 | ||||
XM_011523009.2 | Intron | XP_011521311.1 | ||||
XM_011523010.2 | Intron | XP_011521312.1 | ||||
XM_011523011.2 | Intron | XP_011521313.1 | ||||
XM_011523012.2 | Intron | XP_011521314.1 | ||||
XM_011523014.2 | Intron | XP_011521316.1 | ||||
XM_011523015.2 | Intron | XP_011521317.1 | ||||
XM_011523016.2 | Intron | XP_011521318.1 | ||||
XM_011523017.1 | Intron | XP_011521319.1 | ||||
XM_011523018.1 | Intron | XP_011521320.1 | ||||
XM_011523020.1 | Intron | XP_011521322.1 | ||||
XM_017023157.1 | Intron | XP_016878646.1 | ||||
XM_017023158.1 | Intron | XP_016878647.1 | ||||
XM_017023159.1 | Intron | XP_016878648.1 |