Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTATTGTCCTAGAGGGGAATTATGT[C/T]TAGTGTATAAACAAGTAGTGTCTGC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 603123 | |||||||||||||||||||||||
Literature Links: |
DOCK3 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
DOCK3 - dedicator of cytokinesis 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004947.4 | Intron | NP_004938.1 | ||||
XM_005264914.3 | Intron | XP_005264971.1 | ||||
XM_005264915.3 | Intron | XP_005264972.1 | ||||
XM_005264916.3 | Intron | XP_005264973.1 | ||||
XM_005264917.3 | Intron | XP_005264974.1 | ||||
XM_005264918.3 | Intron | XP_005264975.1 | ||||
XM_006713008.3 | Intron | XP_006713071.1 | ||||
XM_006713009.3 | Intron | XP_006713072.1 | ||||
XM_006713010.3 | Intron | XP_006713073.1 | ||||
XM_011533441.2 | Intron | XP_011531743.1 | ||||
XM_011533443.2 | Intron | XP_011531745.1 | ||||
XM_011533444.2 | Intron | XP_011531746.1 | ||||
XM_011533445.2 | Intron | XP_011531747.1 | ||||
XM_017005825.1 | Intron | XP_016861314.1 | ||||
XM_017005826.1 | Intron | XP_016861315.1 | ||||
XM_017005827.1 | Intron | XP_016861316.1 | ||||
XM_017005828.1 | Intron | XP_016861317.1 |
MIR4787 - microRNA 4787 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |