Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTGCCTCGCCTCCCCCAGTTGCTG[A/G]GGTGCCCTTCTTCAAGCAGTCTCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
63 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602758 MIM: 610568 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC100507670 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
LOC100507670 - uncharacterized LOC100507670 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PI4KB - phosphatidylinositol 4-kinase beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF687 - zinc finger protein 687 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304763.1 | 1078 | Missense Mutation | GAG,GGG | E,G 259 | NP_001291692.1 | |
NM_001304764.1 | 1078 | Missense Mutation | GAG,GGG | E,G 259 | NP_001291693.1 | |
NM_020832.2 | 1078 | Missense Mutation | GAG,GGG | E,G 259 | NP_065883.1 | |
XM_005245366.3 | 1078 | Missense Mutation | GAG,GGG | E,G 268 | XP_005245423.1 | |
XM_011509811.2 | 1078 | Missense Mutation | GAG,GGG | E,G 259 | XP_011508113.1 | |
XM_011509812.2 | 1078 | Missense Mutation | GAG,GGG | E,G 259 | XP_011508114.1 | |
XM_011509813.2 | 1078 | Missense Mutation | GAG,GGG | E,G 259 | XP_011508115.1 |