Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCCAGGCTGAAAGGTTCCCTGAGT[C/T]GAGGTGACTGGTACAAGACAAAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 161015 | ||||||||||||||||||||
Literature Links: |
C11orf72 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C11orf72 - chromosome 11 open reading frame 72 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DOC2GP - double C2 domain gamma pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFV1 - NADH:ubiquinone oxidoreductase core subunit V1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001166102.1 | 328 | Nonsense Mutation | CGA,TGA | R,* 50 | NP_001159574.1 | |
NM_007103.3 | 328 | Nonsense Mutation | CGA,TGA | R,* 59 | NP_009034.2 |