Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGGTCCAGGGGAATGGAGGGAGC[A/C]ATAACTTGAAGAAGGGGGGAAGGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609004 MIM: 601613 | ||||||||||||||||||||
Literature Links: |
BCL9L PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BCL9L - B-cell CLL/lymphoma 9-like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182557.2 | 6159 | UTR 3 | NP_872363.1 | |||
XM_005271511.2 | 6159 | UTR 3 | XP_005271568.1 | |||
XM_005271512.2 | 6159 | Intron | XP_005271569.1 | |||
XM_005271513.2 | 6159 | Intron | XP_005271570.1 | |||
XM_006718815.2 | 6159 | UTR 3 | XP_006718878.1 | |||
XM_011542756.2 | 6159 | Intron | XP_011541058.1 | |||
XM_017017572.1 | 6159 | UTR 3 | XP_016873061.1 | |||
XM_017017573.1 | 6159 | Intron | XP_016873062.1 | |||
XM_017017574.1 | 6159 | Intron | XP_016873063.1 |
CXCR5 - C-X-C motif chemokine receptor 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101929133 - uncharacterized LOC101929133 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |