Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAGAACGGTTGCTATTGGAAGAGC[A/G]ATGTCAGTGATTCAGTCCTATGATA
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612761 | ||||||||||||||||||||||||||||||||
Literature Links: |
LOC101929210 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
LOC101929210 - uncharacterized LOC101929210 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMARCAD1 - SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001128429.2 | Intron | NP_001121901.1 | ||||
NM_001128430.1 | Intron | NP_001121902.1 | ||||
NM_001254949.1 | Intron | NP_001241878.1 | ||||
NM_020159.4 | Intron | NP_064544.2 | ||||
XM_017008463.1 | Intron | XP_016863952.1 | ||||
XM_017008464.1 | Intron | XP_016863953.1 | ||||
XM_017008465.1 | Intron | XP_016863954.1 |
Set Membership: |
HapMap |