Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTGGGATTCTGTTAAGTTTAAGC[T/C]TGGTCTGTGTAAAGACTCTGCTTTA
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
4931413K12Rik PubMed Links |
4931413K12Rik - RIKEN cDNA 4931413K12 gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Gm12338 - cytochrome c oxidase, subunit VIIc pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Pitpna - phosphatidylinositol transfer protein, alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_008850.1 | Intron | NP_032876.1 |