Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGTTCCGAAGTAAACAAGAGAGAA[C/T]AAAGGTTCATAAACTTCTCTAAAGC
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
4921504A21Rik PubMed Links |
4921504A21Rik - RIKEN cDNA 4921504A21 gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Magi2 - membrane associated guanylate kinase, WW and PDZ domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001170745.1 | Intron | NP_001164216.1 | ||||
NM_001170746.1 | Intron | NP_001164217.1 | ||||
NM_015823.3 | Intron | NP_056638.1 |