Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCATGCTAACAGCGCGGATGCACT[A/T]GTGCTCATGCACTTGACGCCCAGCT
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
2310034P14Rik PubMed Links |
2310034P14Rik - RIKEN cDNA 2310034P14 gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Mesdc1 - mesoderm development candidate 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030705.4 | 1789 | Silent Mutation | NP_109630.1 |
Mesdc2 - mesoderm development candidate 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |