Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGATGGACAGCTGTGGTTAACTGCC[C/T]AGGCTCTGAACAAGATCAACATTCT
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
4930557A04Rik PubMed Links |
4930557A04Rik - RIKEN cDNA 4930557A04 gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Hypm - huntingtin interacting protein M | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Sytl5 - synaptotagmin-like 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |