Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACACATTAGTGGGGCAGATGTATA[A/T]GGGGTTAATTACTGGGATTTGAAGG
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
Sema5a PubMed Links |
Sema5a - sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_009154.2 | Intron | NP_033180.2 |