Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAAGTAAATTAGACTTTCACACTG[A/G]TCACTGTTAATTTGCCTATATTTTA
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
4930405O22Rik PubMed Links |
4930405O22Rik - RIKEN cDNA 4930405O22 gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Fbxl17 - F-box and leucine-rich repeat protein 17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015794.1 | Intron | NP_056609.1 |