Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTGAGCCGGAATCGTCAGTTCTCT[C/T]ACTTAATTGAGACTACAGCCCAGGC
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
1700007K13Rik PubMed Links |
1700007K13Rik - RIKEN cDNA 1700007K13 gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Gbgt1 - globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Mrps2 - mitochondrial ribosomal protein S2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001166031.2 | 425 | Missense Mutation | NP_001159503.2 | |||
NM_080452.3 | 425 | Missense Mutation | NP_536700.3 |