Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGTTGACTGACAATAATAACAGTC[T/C]AGAATCCAAGTCAGTTGACCTCATT
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
Gm37013 PubMed Links |
Gm37013 - predicted gene, 37013 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Gm38666 - predicted gene, 38666 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Pcdha7-g - protocadherin alpha 7-gamma | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Pcdhga1 - protocadherin gamma subfamily A, 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033584.1 | Intron | NP_291062.1 |
Pcdhga2 - protocadherin gamma subfamily A, 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033585.1 | Intron | NP_291063.1 |
Pcdhga3 - protocadherin gamma subfamily A, 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033586.2 | Intron | NP_291064.1 |
Pcdhga4 - protocadherin gamma subfamily A, 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033587.3 | Intron | NP_291065.3 |
Pcdhga5 - protocadherin gamma subfamily A, 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Pcdhgb1 - protocadherin gamma subfamily B, 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033574.3 | Intron | NP_291052.3 |
Pcdhgb2 - protocadherin gamma subfamily B, 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |