Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAAGTTCAGGTACCTCAGAGCAAA[A/C]GTTAGGTGAACAGGCTCATTCATCT
Species: |
Mouse |
dbSNP Submissions: |
NA
|
Phenotype: |
|
Literature Links: |
LOC102633666 PubMed Links |
LOC102633666 - uncharacterized LOC102633666 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Pcna - proliferating cell nuclear antigen | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_011045.2 | 762 | Silent Mutation | NP_035175.1 |
Tmem230 - transmembrane protein 230 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |