Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Pipettes and Pipette Tips
    • Lab Centrifuges
    • Ultra-Low Temperature Freezers
    • Spectroscopy
    • Beakers
    • PCR Equipment and Supplies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all product categories
  • Applications
    • Cell Analysis
    • Lab Equipment
    • Real-Time PCR
    • PCR
    • Chromatography
    • Cell Culture and Transfection
    • DNA and RNA Extraction and Analysis
    • Protein Biology
    • Flow Cytometry
    • Chemicals
    • See all applications and techniques
  • Services
    • Custom Services
    • Lab Informatics
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Instrument Services
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Customer Center
    • Contact Us
    • Certificates of Analysis and Conformance
    • Safety Data Sheets (SDS)
    • Manuals
    • How to Cite Our Products in a Paper
    • Instrument Support
    • Knowledge Base and Product FAQs
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › PM15105
          Assay Name: rno-miR-3596a
          miRBase Accession Number: MI0015465
          miRBase Version: v22.1
          Chromosome Location: Chr.8: 45753254 - 45753367 [-] on Build Rnor_6.0
          Mature miRNA Sequence: AACUAUACAACCUACUACCUCA
          Species: Rat, Branchiostoma floridae
          Product Type: Ambion® Pre-miR™ miRNA Precursor
          Assay ID PM15105
          Size
          Availability Made To Order
          Catalog # AM17100
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0001194, mir-3596

          Mature miRNA Sequence:

          AACUAUACAACCUACUACCUCA

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Rat rno-miR-3596a MIMAT0017886
          Branchiostoma floridae bfl-let-7b MIMAT0010006

          Stem-loop Details



          Rat

          Stem-loop ID rno-mir-3596a
          Stem-loop Accession # MI0015465
          Stem-loop Sequence
          GUUGCUUUGUGCAAGUCCCAAGGAAAGCUAGGAGGCUGUACAGUUAUCUCCCUUGUUGUAACUCUAAACUAUACAACCUACUACCUCAGCCUGGGAGCAUGCCGUCACAGUGGC
          Chromosome Location Chr. 8 - 45753254 - 45753367 [-] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0017886
          miRBase ID: rno-miR-3596a
          Mature miRNA Sequence: AACUAUACAACCUACUACCUCA
          Chromosome Location: Chr. 8 - 45753254 - 45753367 [-] on Build Rnor_6.0

          Branchiostoma floridae

          Stem-loop ID bfl-let-7b
          Stem-loop Accession # MI0010517
          Stem-loop Sequence
          GUAUGACCCAAAAAAAGGUAACGGGUUGUACAGUCAUCUCCAAUGUUGUACUUCUGAACUAUACAACCUACUACCUCACCUC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0010006
          miRBase ID: bfl-let-7b
          Mature miRNA Sequence: AACUAUACAACCUACUACCUCA
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Rn03465205_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM15105
          TaqMan™ MicroRNA Assay : 462837_mat
          mirVana® miRNA inhibitor : MH15105
          mirVana® miRNA mimic : MC15105
          TaqMan™ Advanced miRNA Assay : rno481459_mir

          Back To Top

          Related Products

          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Fair Trade Fair Trade
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Thermo Fisher Scientific Korea Ltd.
          Representative : Soojin Seok
          Company Registration No. : 117-81-46910

           

          Thermo Fisher Scientific Solutions LLC
          Representative : Soojin Seok
          Company Registration No. : 114-86-04783

           

          Location: 12F Suseo Office Building, 281 Gwangpyeong-ro, Gangnam-gu, Seoul, Korea(06349) | Mail-Order Business Registration : 2015-Seoul Gangnam-00898 | Payment : ShinHan Bank 140-004-396660 (Thermo Fisher Scientific Solutions LLC)

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-blue-74d7b4b4d9-vlj45:80/100.66.77.38:80.
          git-commit: 7aafa54bd143a040505a257d2a3ebda4095a617f
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.56.0-Offline