TaqMan™ Drug Metabolism Genotyping Assay - FAQs

View additional product information for TaqMan™ Drug Metabolism Genotyping Assay - FAQs (4362691)

68 product FAQs found

How do I set up a reference panel in the TaqMan Genotyper Software?

A reference panel is helpful in large studies to mark your reference samples. Please follow the directions here on how to set up a reference panel.

How do I enter the polymorphism sequence information (i.e., A, C, G, T) for my assays, and where is this info displayed in the TaqMan Genotyper Software?

The polymorphism sequence info can be entered into the software through Setup >Assays. You can import an assay information file (AIF) that contains this info for your assays (AIFs are shipped with assay orders), or manually enter this info for each assay using the edit assay feature. The polymorphism sequence info will be displayed in the assays table under allele1 base and allele2 base, in the results table in the calls column, in the cluster plot display in the x-axis and y-axis titles, and in the export files as genotypes. If no sequence information is entered for an assay, the default display for genotype calls will use the dye names, such as VIC/VIC, VIC/FAM or FAM/FAM dyes.

What is the bookmarking feature in the TaqMan Genotyper Software, and how would I use it?

Bookmarking is a unique feature in TaqMan Genotyper Software that allows you to tag a data point or well while reviewing results in a Study. For example, in reviewing a cluster plot for an assay, a data point is observed to be somewhat between clusters. You can set a bookmark for this data point to denote this well for further investigation. The bookmark persists between the Results workspace and Quality Control workspace, so you can easily identify the data point in a cluster plot, experiment plate view, or on the samples tab. Bookmarks are cleared upon exit from a Study or exit from the application.

I am getting the message: "An error has occurred. See the log file C:\ProgramFiles\Applied Biosystems\TaqMan Genotyper\config\eclipse\1363113099385.log." How can I fix this?

1.Go to the Start button, then Programs, then TaqMan Genotyper Software
2.Right-click on the program and choose “Run as Administrator”
3.If that does not work, go back to the same menu and choose “Properties”
4.Choose the “Compatibility” tab, and check “Run this program as administrator”
5.Click “Apply”
6.You may+C69 have to restart the computer for the settings to apply

Can I delete an assay or sample from my qPCR study?

An assay or sample may be deleted from a study only if there is no data or wells associated with it. Upon import of an experiment, the software collects all the assays and samples from the plate and lists them in the Setup > Assays or Setup > Samples workspaces. The assays and samples are stored in these workspaces as a library, and remain there even if you delete the experiment from the Study. Deleting the experiment will remove any data (wells) associated with the assays or samples, but not the assays or samples from the library. The assays and samples must then be deleted from these workspaces to remove them from the Study.

I have imported experiment files into my study. Can I now edit the assay IDs and/or sample IDs in the TaqMan Genotyper Software?

The software does not allow assay IDs or sample IDs to be modified. If a typing error occurred or an edit is required, this change must be made in the original experiment file. The software does, however, allow you to create your own assay name and add additional information related to an assay or sample through Setup --> Assays or Setup --> Samples.

I have trailing clusters in my allelic discrimination plot. What can I do to improve the clustering?

Trailing clusters are often due to variation in gDNA quality or concentration. Please see the example here for more details (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/qpcr-education/real-time-pcr-troubleshooting-tool/snp-genotyping-troubleshooting/trailing-clusters.html).

I'm getting more than 3 clusters with my qPCR assay. What is wrong?

Multiple clusters such as in the example below could be due to a hidden SNP under the probe or primer. Search dbSNP (https://www.ncbi.nlm.nih.gov/SNP/) for other SNPs around the target SNP. If the nontarget SNP has a low MAF it will usually not be a problem. If the nontarget SNP is under a primer, try to redesign and mask it as an “N”. Another possibility is that the region is within a copy number variation, in which case you will have to evaluate with a TaqMan Copy Number Assay as well.

I'm only getting a single cluster after qPCR. Why is that?

Check the Minor Allele Frequency (MAF) of the SNP. You may need a larger sample size in order to see the allele. You can use the Hardy-Weinberg equation to determine if the minor allele is detectable in your sample size or not. Follow the example here (p. 4-2).

My clusters are too close together when performing qPCR. What can I do?

Depending on the assay, you may want to try either reducing or increasing the number of cycles. Our newer instrument software can even allow you to view the traces if you collect the real-time data on the instrument.

Why is the autocalling in the software not working? What can I do?

If you are not getting calls in the instrument software, you can try the free TaqMan Genotyper Software. This program has an improved algorithm which allows it to make calls that are often missed by the SDS software.

My SNP assay is not amplifying. What is wrong?

There are several reasons for a SNP assay not amplifying, including:

-DNA may not be accurately quantitated
-Degraded DNA
-Inhibitors in the sample
-Error in reaction setup

Check out our troubleshooting tool for more details at https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/qpcr-education/real-time-pcr-troubleshooting-tool/snp-genotyping-troubleshooting/snp-not-amplifying.html.

My custom SNP assay failed and my order was canceled. Why did it fail, and what can I do?

This could happen if the assay fails functional testing. All human SNP genotyping assays get tested with a panel of human gDNA samples. The assay must show amplification with at least one cluster in order to pass. When there is no amplification you will be notified of the failure and not charged for the assay. The assay may have failed for the following reasons:

-Input sequence was incorrect (cDNA instead of gDNA)
-Input sequence was not human
-Input sequence was not appropriately pre-screened
-Signal from NTC was less than 0.5 units from samples (assay did not give high fluorescence signal)

To resolve this, please consult the guidelines in the Design and Ordering Guide (https://tools.thermofisher.com/content/sfs/manuals/cms_042307.pdf) to properly prepare the sequence for the Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays). If the sequence was not human, make sure to select non-human at the species filter step. Nonhuman assays do not get functionally tested.

Can I analyze a triallelic SNP?

Yes, you can analyze a triallelic SNP using paired TaqMan SNP Genotyping Assays. Please refer to this application note for more information (https://tools.thermofisher.com/content/sfs/brochures/cms_055168.pdf).

How do I find positive control samples for my TaqMan SNP Genotyping Assays?

We do not provide control samples. However, Coriell has a large gDNA repository and you may be able to find controls there. Go to: http://ccr.coriell.org/ and choose “SNP Search”. Enter your rs number or gene name. If there are samples available you will see them in the table, such as in this example below. Browse the different genotypes for your desired controls. If a control is not available, you can have one synthesized using GeneArt Gene Synthesis.

What master mix can I use with the TaqMan SNP Genotyping Assays?

We recommend using either the TaqPath ProAmp Master Mix or the TaqMan Genotyping Master Mix. The TaqMan Genotyping Master Mix has the advantage of proven performance with up to 3 days of pre- and post-PCR stability, allowing you to set up plates ahead of time or read the plates later (see the data here, https://tools.thermofisher.com/content/sfs/brochures/cms_039236.pdf) while the TaqPath ProAmp Master Mix can handle samples that may have inhibitors present.

Can I use preamplification with the TaqMan SNP Genotyping Assays?

There is a preamplification protocol included with our TaqMan Sample-to-SNP Kit. This is designed to work with a lysate sample.

How much gDNA should I use with my TaqMan SNP Genotyping Assay?

We recommend using ~1-20 ng of good-quality gDNA per well. The gDNA should have an A260/A280 ratio of ~1.7-1.9. It is also important to try to add the same amount of gDNA to every well.

How should I dilute the TaqMan SNP Genotyping Assays?

We recommend diluting the 40X and 80X TaqMan SNP Genotyping Assays to a 20X working stock with 1X TE buffer. The 1X TE buffer should be 10 mM Tris-HCl, 1 mM EDTA, pH 8.0, and be made using DNase-free, sterile-filtered water.

What does the context sequence in the AIF for TaqMan Drug Metabolism Genotyping Assays indicate?

The context sequence indicates the nucleotide sequence surrounding the probe. The SNP is annotated in brackets as follows: [allele 1_VIC labeled/allele 2_FAM labeled]. As an example the context file may look like: CTCCTCTGACACTGTCGCTTCTCCA[T/C]GGCATTAGATTTTCAGTCCTGCTCA. Please note: 25 nucleotides on each side of the SNP site is included in the context sequence. In this example, the SNP [T/C] can be read as T = allele 1 and is VIC dye labeled, C = Allele 2 and is FAM dye labeled. The context sequence of the assay is always shown in the forward orientation, regardless of the strand on which the SNP is typically reported. It is important to compare the context sequence of the SNP assay to the SNP sequence in the NCBI’s dbSNP database to determine which dye is associated with the minor allele.

What do all of the columns mean in the Assay Index File (AIF) that comes with each TaqMan Drug Metabolism Assay?

A detailed description that highlights all columns relevant to the DMEs can be found in the "Understanding Your Shipment Reference Guide" (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0017153_UnderstandYourShipment_RG.pdf).

My TaqMan Drug Metabolism Genotyping Assay shows some samples clustering with the no template controls. What does this mean?

A sample that clusters with the no template control may indicate that you did not add either DNA or an assay reagent to the reaction well. You may want to redo the experiment. A sample that clusters with the no template control may also indicate the presence of two null alleles in the individual. It is recommended that you repeat the experiment. If the sample again clusters with the no template control, you may want to run a gene dosage assay. All samples that did not amplify in the SNP assay may have a copy number of 0 in the gene dosage assay. Use a positive control to ensure everything else is working.

My TaqMan Drug Metabolism Genotyping Assay cluster plot shows more than three clusters (outliers).  What does this mean?

A cluster plot with more than three clusters may mean that there is an additional SNP under the TaqMan probe or there may be a copy number polymorphism. It is recommended that you perform the assay again to verify the extra cluster. If the extra cluster persists with the same samples, you may want to perform comparative sequencing on the outlier samples to identify if there are any other SNPs present. A persisting extra cluster may also indicate a copy number polymorphism. Homozygous individuals with extra copy numbers of the gene will generally cluster with the homozygous cluster. Only heterozygous individuals tend to fall into a 4 cluster that lies between the heterozygote cluster and one of the homozygous clusters. Therefore, since homozygous copy number variation is somewhat hidden, gene dosage assays should be performed on all samples to determine which individuals carry the extra copies of the gene.

My TaqMan Drug Metabolism Genotyping Assay shows only one cluster. What does this mean?

The presence of a single cluster may indicate that the allele has a very low minor allele frequency (i.e., less than 5% is a rare allele). You should verify the minor allele frequency listed on our website. If there is an allele nomenclature associated with the assay, you may want to refer to the reference paper associated with the polymorphism to determine what population size is needed to see the minor allele. Please note that the minor allele may only occur in certain populations. Visit the article "Interpreting Scatterplots in Genotyping Experiments" in the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for more information.

What controls do you recommend running with a TaqMan Drug Metabolism Genotyping Assay?

In addition to using a no template control, we suggest that you use a positive control (sample with a known SNP genotype). This will help you assess the performance of an assay. Unfortunately, we do not offer positive controls for this product line. Visit the Genotyping section of the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for tips on how to obtain positive controls for genotyping experiments.

Why do the TaqMan Drug Metabolism Assays use a different thermocycling protocol than the other TaqMan SNP Genotyping assays?

In order to design the most optimal assay, the average amplicon length for the TaqMan Drug Metabolism Assays are longer than our other TaqMan assays. Our Research and Development group investigated what PCR conditions produced optimal results with these longer amplicons. They found the DME assays needed more cycles and a longer extension time for optimal results.

What are the suggested methods for quantification of the template used in my TaqMan Drug Metabolism Assays?

We recommend two quantification methods: 1) Quantify genomic DNA using the TaqMan RNase P Reference Assay as outlined in the technical note, RNase P Quantification for Genotyping Experiments (https://tools.thermofisher.com/content/sfs/manuals/MAN0014349_RNase_P_Quantification_QR.pdf) or 2) quantifying the DNA using a reliable method such as a fluorometer like the Qubit, or UV/VIS spectrophotometry (A260/A280 measurement). Please refer to the TaqMan Drug Metabolism Assay Protocol (Cat. No. 4362038).

I want to use less than 3ng of genomic DNA as a template for my TaqMan Drug Metabolism Assay.  What do you recommend?

These assays were evaluated using 3 ng of DNA. If you want to use less than 3 ng, you should run the validation in your lab to verify that the assay can be run with less DNA.

How much  genomic DNA should I use for the TaqMan Drug Metabolism Assays?

We recommend using 3 ng to 20 ng of purified genomic DNA in these assays. We also recommend that you use the same amount of DNA for all samples run with one assay.

Can I use the TaqMan Universal PCR Master Mix with Amperase UNG when running a TaqMan Drug Metabolism Genotyping Assay?

Yes, TaqPath ProAmp Master Mix (Cat. No. A30866) is recommended but you can use several of the master mixes, including TaqMan Universal Master Mix with Amperase UNG (Cat. No. 4304437) or the TaqMan Universal Master Mix without Amperase UNG (Cat. No. 4324018) as indicated in the TaqMan SNP Genotyping Protocol. When using the TaqMan Universal Master Mix with Amperase UNG, you should add a 50 degrees C x 2 min holding stage prior to 95 degrees C x 10 min holding stage. When using the TaqMan Universal Master Mix without Amperase UNG, delete the initial 2 minute 50 degrees C hold stage. However, we now recommend using the TaqPath ProAmp Master Mix (Cat. No. A30865) for the TaqMan Drug Metabolism Genotyping Assays. Please see the TaqPath ProAmp Master Mix User Guide for the recommended thermal cycling conditions.

What type of DNA samples can I use with a TaqMan Drug Metabolism Genotyping Assay?

The assays are designed to be used with purified, human genomic DNA only.

How many reactions come in one TaqMan Drug Metabolism Genotyping Assay?

One tube of a TaqMan DME assay contains enough reagents to perform 750 assays at a 5uL reaction volume (384 well format) and 150 assays at a 25ul reaction volume (96 well format).

Why are some of the TaqMan Drug Metabolism Genotyping Assays missing an rs number?

Some of the assays in the TaqMan Drug Metabolism Genotyping Assay collection are not catalogued in dbSNP, therefore they would not have an rs number.  Some of the polymorphisms in this product line are referenced only on the public allele nomenclature sites, literature, collaborators, etc.

What information do you include on the assay information page for each TaqMan Drug Metabolism Genotyping Assay?  Where is the page located?

The Assay Information page includes the dbSNP ID (when available), the location of the polymorphism on the public genome sequence, the cytoband information, the Minor Allele Frequencies, the polymorphism description, the context sequence, links to the public nomenclature sites (when available), links to phenotype information (when available), and links to literature. The information can be accessed by clicking on the assay name in the search window.

Can I search for a TaqMan Drug Metabolism Genotyping Assay using the nomenclature found on the public Allele Nomenclature sites?

Yes. To find a TaqMan Drug Metabolism Genotyping Assay using allele nomenclature (i.e. CYP2C19*3), you must perform a search from the TaqMan Drug Metabolism Assay search page only. The TaqMan Drug Metabolism search page has the allele nomenclature search enabled. If you try to search for allele nomenclature on another search page (for TaqMan; SNP Genotyping Assays), the search engine will get confused by the * (which is the wild card symbol), and either give you no information or too much information.

What is the DME Assay Index?

The DME Assays Index is a file that you can access and download at: https://www.thermofisher.com/content/dam/LifeTech/global/life-sciences/PCR/qPCR/xls/DME_index_20140630.xlsx. It can be used to identify the Drug Metabolism Assays that are of interest for purchase. The DME Assay Index includes information on the minor allele frequencies for the four populations that we used for our validation tests, the gene to which the polymorphism location is mapped, allele nomenclature (from public allele nomenclature sites, when available), the polymorphism (for example, A/G), the amino acid change (if applicable), the phenotype, and other important information. It is recommended that you view the DME Assay Index in Excel.

Please Note: Although every effort will be made to keep the DME Assay Index current, the most up-to-date information regarding the TaqMan Drug Metabolism Assays will be found on our website by searching for "TaqMan Drug Metabolism Genotyping Assays" and then going to the product description tab.

How do I search for TaqMan Drug Metabolism Genotyping Assays?

There are four ways to locate and order TaqMan Drug Metabolism Genotyping Assays: 1) The TaqMan Drug Metabolism Assays search, 2) using the DME Assay Index file as input to a TaqMan Drug Metabolism Assays search, 3) the TaqMan SNP Genotyping Assay search, and 4) Quick Order.

Why do some of the TaqMan Drug Metabolism Genotyping Assays show zeros for their minor allele frequencies?

We used a sample size of 45 people for each of the four populations that we tested. This sample size provides 95% confidence that you will see alleles with a minor allele frequency of 5%. If the frequency of the minor allele is very low (i.e. rarely occurs),we would have needed large sample size (lots of people) in order to detect the allele. Therefore, the sample sizes of the populations tested for the TaqMan Drug Metabolism Genotyping Assays were too small to detect rare alleles with a high enough confidence.

Are the TaqMan Drug Metabolism Genotyping Assays inventoried?

Yes, there are TaqMan Drug Metabolism Genotyping Assays that are inventoried.

Can I get information about the samples used for validation of the TaqMan Drug Metabolism Genotyping Assays?

We can provide a list, on request, for the samples in the African American and Caucasian population. These DNAs can be acquired from the Coriell organization. We will not be able to provide a sample list for the Japanese and Chinese samples used in our validation studies because these belong to a proprietary collection.

What type of validations did you perform on the TaqMan Drug Metabolism Assays?

These assays were tested on 180 samples from four populations: (45) African American, (45) Caucasians, (45) Chinese, and (45) Japanese. Parameters used to analyze the assays included: cluster signal averages and standard deviations, tightness of clusters, angle separation between clusters, and Hardy-Weinberg Equilibrium.

Can I use the TaqMan Drug Metabolism Assay for diagnostics purposes?

The TaqMan Genotyping Drug Metabolism Assays are labeled For Research Use Only. These assays can be used for clinical research, but they have not been labeled for and should not be used for diagnostic purposes.

What types of polymorphisms are included in the TaqMan Drug Metabolism Assay collection?

The DME collection includes single-nucleotide polymorphisms (SNPs), insertion/deletions (InDels), and multinucleotide polymorphisms (MNPs)

Do you have an assay for every SNP located on the genes included in the TaqMan Drug Metabolism Assay collection?

No, we do not have an assay for every SNP. We have included only coding SNPs in the Drug Metabolism collection. SNPs that occur in intronic regions may be found in the TaqMan SNP Genotyping Assays product line. To find them, enter “SNP Genotyping Assays” as keywords in the main Search field on our website.

What criteria did you use to choose the SNPs in the TaqMan Drug Metabolism product line?

Polymorphisms within the DME collection including single-nucleotide polymorphisms (SNPs), insertion/deletions (InDels), and multinucleotide polymorphisms (MNPs) were identified from three sources: public data including dbSNP, HGMD, and public allele nomenclature sites; collaborations within the pharmaceutical industry; and SNP databases proprietary to Life Technologies Corporation. Initially, all polymorphisms were identified for the 221 genes, and the set was then filtered to include only polymorphisms within regulatory elements, coding regions, and splice junctions. Public allele nomenclature sites were used to help assign common “allele” names to specific polymorphisms in the DME collection. Available common allele names are included in a free downloadable file that contains the polymorphism and refSNP number from dbSNP (if available).

How many assays do you have in the TaqMan Drug Metabolism product line?

Currently there are over 2700 TaqMan Drug Metabolism Genotyping Assays available, which includes assays for 220 genes associated with drug metabolism.

Do the TaqMan PDAR (Pre-Developed Assay Reagents) and TaqMan Drug Metabolism Genotyping Assays interrogate the same polymorphism?

TaqMan PDAR (Pre-Developed Assay Reagents) for allelic discrimination were discontinued. Targets for these reagents were redesigned as TaqMan Drug Metabolism Genotyping Assays to interrogate the same polymorphism, although some targets were updated due to changes in the bioinformatic information.

What is an Allele Frequency?

The allele frequency indicates how often an allele is seen in a total number of chromosomes tested in a given population. For example, the minor allele frequency for the Drug Metabolism Genotyping Assays are calculated based on four populations of sample such as African American, Caucasian, Chinese, and Japanese. The minor allele frequency (MAF) indicates the frequency of the allele that is seen less often in the population.

What are the components of a TaqMan Drug Metabolism Assay?

The DME assay is a pre-designed assay that is tested using gDNA from 45 individuals from four ethnicities. These assays come in a single tube format and contains a locus specific primer pair and two allele-specific TaqMan MGB probes that detect the specific SNP target. The assay is provided as a 20X reaction that contains 900nM primers and 200nM probes, sufficient to perform 750 reactions of 5uL each.

What is a drug metabolism enzyme (DME)?

The drug metabolizing enzymes are proteins involved in the biotransformation, metabolism, and/or detoxification of foreign compounds (i.e. naturally occurring compounds like prosteglandins, drugs, environmental agents, carcinogens, and insecticides). Polymorphisms associated with these genes may influence the rate of foreign compound metabolism within individuals, thus potentially affecting foreign compound efficacy and toxicity. There are three classes of DMEs: Phase I DMEs, Phase II DMEs, and Transmembrane Transporters

The Phase I DMEs assist in oxidation, reduction, and hydrolysis of substances and contribute to increase the hydrophilicity of a compound by adding a functional group.

The Phase II DMEs add another chemical group to a small molecule via a conjugation reaction that include acetylation, glucuronidation, sulfation, and methylation.

The Transmembrane Transporters facilitate movement of drugs/metabolites across cellular membranes.

Should I use standard or fast mode for running TaqMan Drug Metabolism (DME) assays on Quantstudio 7?

The TaqMan DME Assays should be run in standard mode on Quantstudio 7 flex as is the case with all SNP genotyping assays. The initial denaturation for 10 minutes is important for the complete rehydration of the assays, even if a fast enzyme mix is used.

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

What do the different numbers after the underscore, at the end of a TaqMan SNP assay ID, mean?

This is an indication of the version. An assay ID with an _30 would mean the third revision of that particular design (i.e. _10 was first version). For some of the DME assays, there is a capital letter with a number after it (i.e. _A0).

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

How much DNA did you use in the functional test of TaqMan DME genotyping assay (Cat. No. 4362691)?

We used 10 ng DNA per 5 µl reaction.

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

Are the TaqMan SNP assays still being offered as "Functionally Tested" and "Validated and Functionally Tested" assays?

Yes. Each TaqMan SNP Genotyping Assay is functionally tested for match to respective mixed ethnic populations. Within each category of the assay list, validated assays are tested across 45 individuals for each population to meet stringent performance criteria, including minor allele frequencies from various sources such as Hapmap, JSNP, NCBI, and/or AGI (Applera Genome Initiative) for additional information. In comparison, functionally tested assays are tested against a mixed ethnic population, consisting of approximately 10-20 individuals, but these may not have results for some minor allele frequencies due to the small and mixed sample set used in the test. This applies to the Custom TaqMan SNP Genotyping Assays for humans, but not for nonhuman SNP assays.

I would like to order a TaqMan SNP Genotyping Assay. Does the kit include everything I need to perform my experiment or do I need to purchase reagents separately?

Each predesigned TaqMan SNP Genotyping Assay is delivered in a single tube consisting of two differentially labeled allele-specific TaqMan MGB (minor groove binding) probes and a pair of PCR primers. For more information, please see the following link: https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-applications/genetic-variation-analysis-using-real-time/snp-genotyping-with-real-time-pcr.html

Besides the TaqMan SNP Genotyping Assay, you would need to purchase a Genotyping Master Mix and nuclease-free water. A list of compatible master mixes can be found in the following link: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0009593_TaqManSNP_UG.pdf.

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

What are the storage conditions for the TaqMan and Custom TaqMan Gene Expression and SNP Genotyping Assays?

After shipment, the assay mixes should be stored at -15 C to -20 C to maximize stability. Freeze/thaws should be kept to a minimum (a maximum of 10 freeze-thaw cycles is recommended). Keep all TaqMan and Custom TaqMan Gene Expression and SNP Genotyping Assays protected from direct exposure to light. Excessive exposure to light may affect the fluorescent probes. If desired, the Assay Mix may be diluted with TE buffer or DNase-free Water. It is recommended to make working stocks from the stock solutions provided in these kits.

Find additional tips, troubleshooting help, and resources within our TaqMan Primers and Probes Support Center.

Why is the auto calling in the instrument software not working? What can I do?

If you are not getting calls in the instrument software, you can try the free TaqMan Genotyper Software (https://www.thermofisher.com/qpcrsoftware). Another option is the Genotyping App on the Thermofisher Cloud (https://www.thermofisher.com/cloud). These programs have improved algorithms which allow them to make calls that are often missed by the instrument software. In addition, make sure you are running a sufficient number of samples (more than 3), and include at least one NTC well which is labeled in the software.

Why can I not find a TaqMan DME Genotyping assay to my target?

TaqMan SNP Genotyping Assays are an ideal technology for interrogation of most DME and clinical research target polymorphisms, offering highly specific target amplification and allele discrimination. However, there are some polymorphisms that are not well‐suited for TaqMan assay development. These include targets that: 

  • Reside in highly polymorphic genomic regions (polymorphisms interfere with amplification in some samples) 
  • Share high sequence identity with another genomic region (base differences are not available for specific assay development)
  • Are microsatellite polymorphisms, or 
  • Are base deletions within a homopolymer sequence. A list of commonly requested DME and clinical research targets that are not good candidates for TaqMan Assay design and suggestions for alternative technologies to use are included in the PGx Common Markers file

I have imported experiment files into my study, can I now edit the assay IDs and/or sample IDs in the TaqMan Genotyper Software?

The software does not allow assay IDs or sample IDs to be modified. If a typo occurred or an edit is required, this change must be made in the original experiment file. The software does, however, allow you to create your own assay name and add additional information related to an assay or sample through Setup -->Assays or Setup -->Samples. 

I am doing DME genotyping and am only getting a single cluster. Why is that?

Check the Minor Allele Frequency (MAF) of the SNP. You may need a larger sample size in order to see the allele. You can use the Hardy-Weinberg equation to determine if the minor allele is detectable in your sample size or not. Follow the example here (p. 4-2).

I am doing DME genotyping and my clusters are too close together. What can I do?

Depending on the assay, you may want to try either reducing or increasing the number of cycles. Our newer instrument software can even allow you to view the traces if you collect the real-time data on the instrument.

How do I make a reference panel in TaqMan Genotyper?

A reference panel file is a user-generated TaqMan Genotyper Software file that contains reference samples. Reference samples are data points in an experiment that you select to be representative of the clusters for an individual assay. You can identify, collect, and store reference samples for multiple assays in a reference panel file for use in current or future studies.

After you import a reference panel file into a study, the software uses the reference samples to bias the calls of Unknown data points. Below are instructions how to create a reference panel in the TaqMan Genotyper Software.

In the current study, select the sample to be included in the reference panel. Click on the Tag menu, and select Tag for Reference Panel. Repeat this for all samples and assays you want to include in your reference panel. When you are ready to analyze a new study, select References under the Setup menu. Click on import, and navigate to the reference panel file (.lap) that you previously saved. You will first need to import your AIF file, and the assays in your reference panel must be included in your assay list.

I cannot find a pre-designed assay to my target. Do you have a custom option?

Targets of interest that are not covered by the current Applied Biosystems TaqMan SNP Genotyping collection can be submitted to Custom TaqMan SNP Assay design. 

The Custom TaqMan Assay Design Tool (CADT) is available on www.thermofisher.com. Order a custom TaqMan SNP Genotyping Assay by first entering a sequence with the SNP in brackets, for example [A/G], then submitting the chosen target sites for assay design. Upon notification of successful assay design by email, click the link in the message and add the desired custom assays to your shopping basket. 

CADT can be used to design assays targeting biallelic SNPs or insertion/deletion polymorphisms and multi‐nucleotide polymorphisms (MNPs) that are 6 bases or fewer in length. This tool can also be used to input and order primer and probe sequences of assays that have already been designed that contain FAM or VIC labels and MGB‐NFQ quenchers. 

Note that sequences must be SNP and repeat‐masked before submission to CADT. Additionally, the genome‐uniqueness for assays must first be established, because custom assays are not compared to the genome (e.g., by BLAT or BLASTn) to determine target specificity. Any target on the “unavailable list” (described on page 25) should not be submitted to CADT, because an assay may be designed but it will fail to function properly. For targets that present assay design challenges, contact our fee‐for‐design custom assay design service at custom.solutions@thermofisher.com.

How can I find out what TaqMan DME Genotyping assay I need to detect a particular star allele?

Common allele names, and the corresponding TaqMan DME Genotyping assay, are provided for many DME variants in the PGx Common Markers file (https://www.thermofisher.com/content/dam/LifeTech/Documents/XLS/PGx_Common_Markers_25Jan2014.xlsx).

The public allele nomenclature websites provide information on known DME gene star allele haplotypes, the defining polymorphisms for these alleles, and in many cases, links to the NCBI dbSNP website if an rsSNP identifier has been assigned. Below is a list of DME allele nomenclature websites for specific gene families:

- CYP - Cytochrome P450 (CYP) gene family: http://www.cypalleles.ki.se
- NAT1 and NAT2 - Arylamine NAcetyltransferase gene family: http://nat.mbg.duth.gr
- UGT - UDP Glucuronosyltransferase gene family: http://www.pharmacogenomics.pha.ulaval.ca/ cms/ugt_alleles

What is a star allele?

Star alleles are gene‐level haplotypes (a set of DNA polymorphisms that tend to be inherited together on the same chromosome). In many cases, these haplotypes have been associated with DME activity levels (e.g., functional, decreased function, or nonfunctional variants). The combination of star allele haplotypes (i.e., the diplotype) within a sample can be used to predict the DME phenotype (e.g., ultrarapid, extensive, intermediate, or poor). Genetic variants within a haplotype can include SNPs, InDels, and CNVs. The allele nomenclature for a specific gene family is maintained and standardized by an affiliated group of scientists that curate each site independently. This nomenclature can be complicated, because many alleles contain more than one polymorphism (i.e., they are haplotypes) and conversely, many polymorphisms are associated with several alleles.

The star allele nomenclature contains the DME gene name, such as CYP2D6, followed by a numeric allele name, such as *3. A star allele conventionally contains at least one causative variant (e.g., a frameshift mutation). Variants are given reference gene and/or cDNA coordinates, such as g.2549delA (full variant name: CYP2D6*3 g.2549delA). The causative star allele variant may be associated with other nucleotide variants in different haplotypes groups; such sub‐alleles are denoted by letters following the numeric allele identifier (e.g., *3A). On the Cytochrome P450 (CYP) Allele Nomenclature web site, the defining, causative variant for a star allele is often in bold font. 

Note: *1 refers to the reference gene sequence, which has normal function. The reference gene sequence is not necessarily equivalent to the reference genome assembly sequence and it does not necessarily contain the major allele for a given SNP (which can vary between populations, particularly for highly polymorphic SNPs). 

The defining variant for a given DME gene star allele may be the only variant that needs to be interrogated to identify that particular star allele. The defining allele is sometimes referred to as the “common allele”.

What master mix can I use with the TaqMan DME Genotyping Assays?

We recommend using the TaqMan Genotyping Master Mix. TaqMan Genotyping Assays are also compatible with Universal Master Mix II and Sample-to-SNP GTXpress Master Mix reagents.

In my TaqMan DME Genotyping Assay, which base is labeled with FAM or VIC dye?

The reporter dye information for TaqMan Drug Metabolism and SNP Genotyping Assays can be found in the context sequence, which is posted on the Thermo Fisher Scientific website and in the Assay Information File (AIF) that is on your assay order CD. The context sequence is the nucleotide sequence surrounding the SNP site. It is provided in the genome strand orientation relative to the NCBI reference genome. The SNP alleles are included in brackets, where the order of the alleles corresponds to the association with probe reporter dyes, where [Allele 1 = VIC dye / Allele 2 = FAM dye].

For example, the C__27102431_D0 assay, which targets the CYP2D6*4 g.1846G>A SNP, rs3892097, has the following context sequence: 

AGACCGTTGGGGCGAAAGGGGCGTC[C/T]TGGGGGTGGGAGATGCGGGTAAGGG

The VIC dye probe is associated with the C allele and the FAM dye probe is associated with the T allele.

Note that occasionally the SNP alleles we provide in the context sequence are the complement of those listed on the NCBI website, or of those given in the star allele nomenclature. This is because we provide the context sequence alleles in the reference genome strand orientation, but in this example, RefSNP alleles in dbSNP (NCBI) and the star allele nucleotide changes are provided with respect to the CYP2D6 gene reference sequence that maps to the genome strand: CYP2D6*4 g.1846G>A. In the case of A/T, T/A, C/G, or G/C polymorphisms, it is important to note the context sequence to make sure that you have identified the alleles correctly.

For custom assays, only probe sequences are provided for designs created by the Custom Assay Design Tool (CADT). The alleles corresponding to VIC dye and FAM dye are determined by the order of the SNP alleles included in brackets of the sequence you submitted for assay design, where the order of the alleles corresponds to the association with probe reporter dyes, where [Allele 1 = VIC dye / Allele 2 = FAM dye]. If you no longer have the submitted sequences and have trouble determining which allele is detected by each dye based on the probe sequences in the AIF on the CD you can contact tech support for help.

If a custom assay is designed based on the reverse strand sequence, the alleles detected by each dye are the same as they would be for an assay based on the forward strand sequence. For example, if a submitted SNP sequence is …GTC[C/T]TGG … the VIC probe sequence in the AIF file may contain …GTCCTGG… or the reverse complement …CCAGGAC… and the FAM probe sequence may contain …GTCTTGG… or the reverse complement …CCAAGAC… of the context sequence. Both the forward and reverse strand VIC probes target the C allele and both FAM probes target the T allele of the SNP.

When designing probes to perform Allelic Discrimination (SNP assays), are there any alternatives to using probes longer than 30bp in order to get the appropriate melting temperature?

Applied Biosystems TaqMan MGB (minor groove binder) probes would be appropriate for Allelic Discrimination/SNP Genotyping probe designs. TaqMan MGB probes have a minor groove binder at the end of the probe. This minor groove binder increases the Tm of probes, allowing the use of shorter probes. Consequently, the TaqMan MGB probes exhibit greater differences in Tm values between matched and mismatched probes, which provides more accurate allele discrimination.

For information on the design of TaqMan MGB probes for Allelic Discrimination/SNP assays using Primer Express software, please refer to our guide "Designing TaqMan MGB Probe and Primer Sets for Allelic Discrimination Assays Using Primer Express".