Search
Search
View additional product information for Custom TaqMan™ Small RNA Assay - FAQs (4398987, 4398988, 4398989, 4440418)
60 product FAQs found
The TaqMan miRNA asays are guaranteed to meet the following:
Dynamic Range: > 6 logs10 with > 0.97 linearity (R2 value)
Specificity: Majority of assays have < 5% cross reactivity with closely related sequences. NTC background: Ct > 38.0
Lot-to-Lot Reproducibility: Difference between Ct's < 0.6 Ct when different lots of an assay are run with the same sample and master mix from the same lot on the sample plate
Amplification Efficiency: ranging from 90-110% across 5 logs10
Please see the document TaqMan Assays QPCR Guarantee Program for more details.
If you are using an Applied Biosystems instrument, we recommend using Expression Suite to analyze data from the TaqMan MicroRNA Array Cards. After importing the .sds or .eds files, you can perform all the QC and data analysis within the tool. For more details on how to use Expression Suite software, please see this video series: https://learn.thermofisher.com/courses/view/id/325
It is well understood within the miRNA community that designing assays for miRNAs is challenging due to their short length (<22 bases) and closely related sequences. Although we have not tested cross reactivity of every closely related species, we have demonstrated that we can achieve <5% cross reactivity between a single nucleotide mismatch. Specificity of an assay depends on the number of mismatches to its closest homologue, the location of the mismatch, and the surrounding bases, making cross reactivity difficult to predict. As a general rule, the most difficult miRNA targets to discriminate are those with minimal mismatches localized to the 5' region of the sequence, and it is close to impossible to design an assay that discriminates between a single mismatch at the 5' most base. In addition, the assays in our catalog have been designed to provide a balance between specificity and sensitivity: an assay may be very specific but lack the needed sensitivity, or vice versa. To achieve this balance, and to ensure the highest sensitivity and to reduce false positives, TaqMan MicroRNA Assays must have an NTC background Ct > 38.0 and display good linearity across at least 3 logs10 (ideal R2 > 0.98).
Deep sequencing analysis of mature miRNAs revealed that many miRNAs have either an addition or deletion of 1-3 bases at the 3' and less frequently at the 5' terminal end. These are often referred to as isomiRs. The sequence deposited in miRBase is the canonical sequence derived by aligning sequences from current deep sequencing data. Thus far, there has been no biological relevance attached to these different forms since they exclusively occur outside the seed sequence. For that reason, the changes detected in the expression level of one isomer are proportional to changes within the entire pool. As a result, there may be a shift in raw Ct value using assays targeting two separate isomiRs. However, the relative expression ddCt has been demonstrated to be roughly the same. It should be noted that, although TaqMan MicroRNA Assays are designed to be sequence specific, they will detect a small spectrum of isomiRs. Depending on the number and composition at the 3' end, an assay may detect the +1 and +2 isomiRs but not the -1 or -2 forms.
Use multiple replicates and consider, when possible, using an overall study control that is used in every assay to monitor potential day-to-day/run-to-run/across study variability.
TaqMan MicroRNA Assays provide excellent lot-to-lot reproducibility, with a maximum deviation range of 0.5 Ct's between different lots. We advise running a control sample with both lots in parallel to ensure continuity in your experiments.
Custom TaqMan Small RNA assays can be designed using the Custom Small RNA Design Tool by entering the RNA sequence of interest: https://www.thermofisher.com/order/custom-genomic-products/tools/small-rna/
Any alternative designs may not meet our strict specifications for specificity or performance in general.
The error message means a high performing assay cannot be designed to that sequence.
Error messages may include the following:
Error Message 1 - We have been unable to design a high-performing assay for this sequence in the past.
Error Message 2 -The submitted sequence failed design. The design may have failed due to high G/C content, high A/T content, or the potential of the submitted sequence to create self-dimers.
Error Message 3 - One or more of the assay oligonucleotides cannot be manufactured in a way that meets Thermo Fisher Scientific high-performance standards.
Errors may also be generated under these particular cases:
- The submitted sequences is less than 15 nucleotides in length.
- There is presence of palindromes at 3' end of the submitted sequence.
- The assay sequences may generate excessive self-dimerization.
- The submitted sequence has a high G/C content.
- The submitted sequence has a high A/T content.
The TaqMan miRNA assays are available in: Extra Small (XS) Small (S) Medium (M) Large (L).
Yes. This is the recommended master mix for TaqMan MicroRNA Assays. You can use Universal Master Mix or Universal Master Mix II (with or without UNG). You can also use the Fast Advanced Master Mix.
Yes. Refer to Protocol for Creating Custom RT and Preamplification Pools using TaqMan MicroRNA Assays (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/4465407_CustomRT-preamp_UG.pdf) for detailed information. When pooling fewer than 12 assays together, you can reduce the final volume but keep the final concentration of each assay in the pool at 0.2X (i.e. by diluting each 20X TaqMan MicroRNA Assay 1:100X)
Pre-amplification was developed for use with small sample size as a means to stretch your sample. At the same time, the variability of the Ct value is reduced for low copy number transcripts.
Yes. If you are using individual TaqMan MicroRNA Assays, you can prepare your own RT and PreAmp pools. Refer to Protocol for Creating Custom RT and Preamplification Pools using TaqMan MicroRNA Assays (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/4465407_CustomRT-preamp_UG.pdf) for detailed information. Although this protocol has been tested by our development group, we recommend that you validate the performance of the particular pool that you are interested in working with. At a minimum, we recommend running a No Template Control (NTC). The NTC is crucial to identify any primer interactions that may increase the background.
Selecting a good endogenous control is imperative for good data normalization; see details in our Application Note by searching for Endogenous Controls for Real-Time Quantitation of miRNA Using TaqMan MicroRNA Assays. For a large number of targets (e.g., beyond 380), you can use the Global Mean Normalization method (Mestdagh et al. 2009 Genome Biology, http://genomebiology.com/2009/10/6/R64). ExpressionSuite, a free gene expression data analysis tool, provides global normalization when using large number of samples. It also provides the selection of single or multiple endogenous controls. You can download ExpressionSuite for free from our Technical Resources page under Software, Patches, and Updates.
Spike-ins or exogenous controls are recommended when it is necessary to monitor for extraction efficiency or sample input amount with difficult samples (for example with serum/plasma, other biofluids). A spike in control should be a target sequence that is not present in your sample. For example, ath-miR-159a is not present in humans so is a good spike in control for human. Exogenous controls are synthetic RNA oligonucleotides that match the target sequence. The RNA oligo does not require a 5' phosphate and HPLC purification is not necessary. We recommend using 5-10 pM for each spike in control. We have TaqMan MicroRNA Assays available for a number of miRNAs that can be used as spike in controls with human samples (ath-miR-159a; cel-miR-39-3p cel-miR-2-3p).
As with any other targets, the particular Ct value will depend on multiple factors, such as the tissue type and its condition, the input amount of RNA, the sample preparation method, etc. In the tissue samples we have looked at the U6 is moderately expressed.
Small RNAs such as snRNAs or snoRNAs are usually not present in serum or other body fluids. Spike in controls can be used to monitor sample preparation. Any miRNA that is present in your serum samples can be used as a control as long as it is stably expressed across all the sample types in your study. You can refer to the literature for candidate miRNAs to test or you can select of a control from your data set to use in your analysis.
It is important to select the appropriate endogenous control to normalize your data. Thermo Fisher Scientific has identified a number of small non-coding RNAs (snoRNAs, snRNAs) that show stable, moderate expression across a large number of tissues for human and mouse that are therefore good candidates for an endogenous control. Candidate controls are also available for rat, Drosophila, Arabidopsis and C. elegans. An updated list of available controls can be found on our portal (www.thermofisher.com/taqmanmirna) by selecting MicroRNA and then Controls, followed by the species of interest as search options.
In general, any miRNA can be used as an endogenous control to normalize results across different samples as long as it meets the criteria of a good endogenous control: providing stable expression levels with minimal variation across the different sample and conditions being used in your study. Since a control for one experimental study/treatment may not be appropriate for another one, a control should be validated before use. One approach is to select the control(s) based on your data set. An Application Note that describes how to perform validation using simple statistical methods, i.e., by measuring the Standard Deviation of the average Ct, is available: Endogenous Controls for Real-Time Quantitation of miRNA Using TaqMan MicroRNA Assays (http://tools.thermofisher.com/content/sfs/brochures/cms_044972.pdf). Alternatively, you can use geNorm (Vandensompele et al. 2002 Genome Biology, http://genomebiology.com/2002/3/7/research/0034) to determine which of the candidate controls is best to use for your study.
Searching by sequence of a given miRNA is the most accurate way to ensure finding the right assay for that particular miRNA. In some cases, when searching by Assay Name, multiple assays are found bearing that Assay name. Two different assays may have the same Assay Name when miRBase modifies the sequence of an existing miRNA but retains the same miRNA ID as the old one for the new sequence. As an example, Assay 000385 was designed to target hsa-miR-1, the human miR-1 introduced with miRBase v2.0, and assigned hsa-miR-1 as the Assay Name to reflect the annotation in miRBase. When the sequence for the human miR-1 was changed in a later release of miRBase (v10.1), Assay 002222 was designed to target the new sequence. As a result, both assays are named hsa-miR-1 in alignment with miRBase. Due to the change in sequence for human, Assay 000385 no longer maps to the human miRNA. However, this assay still targets the miR-1 in all those species whose sequence has not changed since miRBase 2.0
Because of the potential instability of miRBase, names can sometimes be misleading; therefore searching by miRNA sequence is the most accurate method to search for an assay.
Check the target sequence listed in the search details to ensure it corresponds to your needs. If you are not sure about the sequence of your miRNA of interest, first verify it by looking up the associated miRNA on miRBase.org and reviewing the reference information to make sure you select the correct miRNA.
Go to the URL: www.thermofisher.com/taqmanmirna
1. Select MicroRNA under What type of experiment are you conducting?
2. Select Mature miRNA under What type of miRNA are you interested in?
3. Select the name of the Species that the assay needs to target.
4. Specify the assay or the mature miRNA targeted by entering one of the following pieces of information: Assay ID, miRBase ID, Accession #, or miRNA target sequence.
If the search returns a large number of results, these can be narrowed with the filters in the left hand of the screen, e.g.: by selecting for Inventoried Assays only, or by selecting specific species.
You can also check out this short video on how to search for an assay:
http://www.youtube.com/watch?feature=player_embedded&v=kbYa0hsglD8
An assay would lose its annotation when it no longer maps to an annotated miRNA (i.e. the miRNA was removed from miRBase); as a result, the annotation fields on the website are empty. For example, the sequence UGUAAACAUCCUUGACUGGA was last mapped to hsa-miR-30e-5p in miRBase v9.2. It has since been removed from the database and replaced with a sequence that is 2 bases longer at the 3' end: UGUAAACAUCCUUGACUGGAAG.
An alias is the miRBAse ID for a given miRNA from an earlier version. Alias information is found in the Details section of the search results. The miRBase release version shown in parentheses represents when the alias miRBase ID was last listed.
An assay for a human miRNA may have a lower species name because the target sequence was first introduced and published in miRBase for that species and only later found in human. For example, mmu-miR-124a was first introduced as a mouse miRNA. The human miRNA was introduced later.
When a sequence that maps to multiple species is introduced into miRBase, the assay name is given according to the following hierarchy: hsa, mmu, rno, dre, cel, ath, and then alphabetically for the remaining species. Thus if an assay maps to human, mouse and c. elegans simultaneously, it will be named hsa-miR-nnn.
TaqMan MicroRNA Assays are given a unique and invariable Assay ID. The Assay ID, as well as the assay design, i.e. the sequences of the oligos composing the assay (RT, forward and reverse primers, and TaqMan probe), do not change. The Assay Name is the miRBase ID for the targeted miRNA sequence when the assay was first released. miRBase IDs are known to be unstable as there have been multiple changes over time: Annotation changes include revised miRNA sequences for the same miRBase ID, and updated miRBase IDs. Thus, a sequence may have a different miRNA ID from the one it originally had, or a given miRNA ID may have a modified sequence. The assay, however, is still completely functional for the sequence for which it was originally designed. It is always recommended to use the miRNA sequence or miRBase Accession Number to confirm that a given assay will target a specific miRNA.
Accession numbers are unique identifiers assigned to both hairpin (e.g.: MI0000015) and mature (e.g.: MIMAT0000029) sequences. While miRBase names may change, the accession numbers are stable and remain associated with a specific sequence.
The mirBase ID is the official miRBase name given to a mature miRNA sequence. There may be multiple miRBase IDs for a given mature miRNA sequence because many miRNAs are conserved across species (for example, several hundred human miRNAs have the identical sequence in common with the mouse species). The miRBase ID consist of a 3 letter species identifier, including the first letter of the genus and the first two letters of the species, followed by the expression miR, and then a numeric suffix, e.g.: hsa-miR-212. Since two distinct mature miRNAs can be derived from the different arms of the same stem-loop precursor, a -5p or -3p suffix specifies the particular arm of the stem from which they come, e.g.: hsa-miR-501-5p is derived from the 5' end of the stem, while hsa-miR-501-3p is derived from the 3' end. The miRNA gene and hairpin precursor locus name is given lower case: hsa-mir-212. If a mature miRNA is predicted to be expressed from more than one hairpin precursor, then a numeric suffix is added to the precursor name. For example, hsa-miR-101 is expressed from two precursor loci, hsa-mir-101-1 and hsa-mir-101-2. Closely related miRNAs are given lettered suffixes (hsa-miR-19a-3p and hsa-miR-19b-3p) and are expressed from similarly named precursors (hsa-mir-19a-3p and hsa-mir-19b-3p).
miRBase continues to re-annotate the miRNA sequences as more information becomes available. Updated versions of miRBase are released on a regular basis. At the time of print (June 2013), it was up to v20.
Currently the only species for which there are endogenous controls available are human and mouse. However, within the experimental study, a researcher may be able to identify a microRNA that remains constant across their samples and use that as the endogenous control. More TaqMan miRNA assays are released regularly, so please check the Thermo Fisher Scientific website for new assays.
Human TaqMan miRNA endogenous controls currently available include: miRNA for tissues: hsa-miR-26b, hsa-miR-92, hsa-miR-92N; miRNA for cell lines: hsa-miR-423, hsa-miR-374, hsa-miR-16; sn/snoRNAs: RNU48, RNU44, U47, RNU6B, or all four.
Mouse TaqMan miRNA endogenous controls currently available include: snoRNA202, snoRNA234, or both.
RNA interference has evolved to describe the process for repressing or silencing gene expression. Whether the small RNA that triggers the event is of an endogenous (miRNA) or exogenous (siRNA/shRNA) origin, the mechanism is similar. The RNA interference pathway (RNAi) is a process in which a double-stranded RNA (dsRNA) triggers the degradation of a homologous mRNA. An enzyme called Dicer cleaves the dsRNA into small duplexes of 21-25 nucleotides. The siRNAs are combined into a multi-protein complex called RISC (RNA-induced silencing complex), and the RISC is guided to mRNAs that have perfect homology with the siRNAs, targeting them for sequence-specific degradation. MicroRNAs are thought to be processed by the same cellular mechanism as the RNAi pathway including Dicer and the RISC complex. RNAi has become a tool to study gene function by blocking the expression of specific mRNAs and generating knockdowns (reverse genetics).
Earlier naming convention used the miR/miR* (a.k.a. non-star/star) nomenclature to identify the mature miRNA that was predominantly expressed from a precursor stem loop. This nomenclature has been phased out and replaced with -5p/-3p in miRBase. Thermo Fisher Scientific continues to use the star in the Assay Names for those assays that were released when the star convention was in use by miRBase.
The comparative Ct method is recommended. See the Guide to Performing Relative Quantitation of Gene Expression Using Real-Time Quantitative PCR, available at www.thermofisher.com (search for Cat. No. 4371095)
TaqMan MicroRNA Assays are highly specific. The assays are designed to detect mature miRNA sequences and can distinguish between the mature miRNA and its precursor. In addition, these assays can often distinguish between miRNA targets that differ by only a single nucleotide.
The specific TaqMan miRNA Assay consists of the reverse and forward primers and TaqMan FAM-MGB fluorescent dye-labeled probe at a 20X concentration. It also includes a separate miRNA-specific reverse transcription (RT) primer. The TaqMan miRNA Assays are designed using a miRNA design process and are not designed through the TaqMan Gene Expression Assay pipeline. The primer and probe concentrations have been optimized for miRNA amplification and are different from the TaqMan Gene Expression Assays. The assays are performed using universal cycling conditions on any Applied Biosystems Real-Time PCR instrument system. For more detailed information please consult the TaqMan MicroRNA Assays Protocol.
Custom TaqMan Small RNA Assays use, by default, FAM as a reporter and MGB-NFQ as a quencher. However, it is possible to use different dyes and quenchers.
Find additional tips, troubleshooting help, and resources within our TaqMan Protein Assay Support Center.
To reorder the same Custom TaqMan Assay, you can follow these steps:
- Select an appropriate catalog number, considering the size of the assay that you want. You can find the different catalog numbers for Custom TaqMan Assays on their respective product pages on thermofisher.com.
- Once you have identified the necessary catalog number, go to www.thermofisher.com and click on "Quick Order", in the top right corner of the screen.
- In the following page, paste your selected catalog number in the "Catalog Number" field and paste the assay ID from your previous order in the "Assay ID" field.
- Click "Add to cart" and then in the following screen click "Proceed to check out".
Yes. Please find the instructions for creating a padded amplicon in this video:
players.brightcove.net/3663210762001/NkeAhMvjg_default/index.html?videoId=5835962438001
Please review the following possible causes and solutions:
-The sample evaporated. Check the seal of the adhesive film for leaks.
- The well is empty because of inaccurate pipetting. Check the calibration of the pipettes, and pipette at least 5 µL of sample.
- The well is assigned a sample or target in the plate document or experiment, but the well is empty. Ensure that the plate document or experiment is set up correctly. Try excluding the well, then reanalyzing the data.
A small ΔRn can mean that the PCR efficiency was poor. Ensure that the reagents were used at the correct concentration. Alternatively, the quantity of the cDNA may be low (a low copy number of the target). In this case, we recommend that you increase the quantity of the cDNA in the reaction.
Most likely the fluorescence did not stabilize to the buffer conditions of the reaction mix.
Note: This condition does not affect PCR or the final results.
We recommend that you try the following possible solutions:
- Reset the lower value of the baseline range.
- Use an automatic baseline.
- Use the relative threshold algorithm (Crt). See Introduction to Gene Expression Getting Started Guide (Pub. No. 4454239).
Amplification in the no-RT control can be due to the cDNA template or amplicon being contaminated. Please follow established PCR good laboratory practices.
Please review the following possible causes and solutions:
- Contamination occurred. We recommend that you run no-RT control to confirm that there was genomic DNA (gDNA) contamination. We also recommend the use DNase to ensure minimal gDNA contamination of the RNA.
- Too much cDNA template was added to the reaction. We recommend that you quantitate the RNA before the reverse transcription (RT) reaction. After the RT reaction, adjust the concentration of cDNA before adding it to the reaction.
- The cDNA template or the amplicon is contaminated. Follow established PCR good laboratory practices.
Please review the following possible causes and solutions:
- The reagents were not mixed properly. Increase the length of time that you mix the reagents. We recommend that you confirm your mixing process by running a replicate assay.
- Pipetting was inaccurate. We recommend that you check the pipette calibration, and pipet at least 5 µL of sample to prepare the reaction mix.
- The threshold was not set correctly. Set the threshold above the noise level and where the replicates are tightest. See your real‑time PCR system user documentation for more information about setting the threshold.
- There was a low concentration of the target of interest. Rerun the assay with more cDNA template.
- Ct is not the most appropriate analysis for the data. We recommend that you try using relative threshold (Crt) analysis. See Introduction to Gene Expression Getting Started Guide (Pub. No. 4454239).
Please review the following possible causes and solutions:
- The endogenous control is not consistently expressed across the samples. Ensure that the endogenous control is consistently expressed in your sample type. We recommend that you use an alternative endogenous control such as a nonvariable miRNA.
- The sample concentrations vary. We recommend that you quantify and normalize the PCR samples before running the assay.
- Pipetting was inaccurate. We recommend that you check the pipette calibration, and pipet at least 5 µL of sample to prepare the reaction mix.
It is possible that the reagents are contaminated with amplicons. We recommend that you clean your workspace and equipment, then rerun the assay using new reagents. We also recommend that you run no-RT controls to rule out genomic DNA contamination, and treat the sample with DNase.
Most likely the ROX dye was not set as the passive reference. Set ROX dye as the passive reference, then reanalyze the data.
This can be caused by incorrect dyes selected for each target. Check the dyes selected for each target, then reanalyze the data.
This is most likely due to the sample evaporating. We recommend that you check the seal of the adhesive film for leaks before running the plate on the real-time PCR instrument.
Please review the following possible causes and solutions:
- Precipitation present in the buffers. Before preparing reactions, please make sure that you mix the Master Mix thoroughly to produce a homogenous solution.
- Reagents are degraded. Ensure that the kits and reagents have been stored according to the instructions on the packaging and that they have not expired.
Please review the following possible causes and solutions:
- The sample does not have enough copies of the target RNA. To confirm the results, we recommend that you rerun the sample using the same assay and/or rerun the assay using more of the sample. Also avoid PCR reaction mix with more than 20% from the reverse transcription reaction.
Note: If the recommended actions do not resolve the problem, the result may be correct.
- One or more of the reaction components was not added. We recommend checking your pipetting equipment and/or technique.
- Incorrect dyes were selected for each target. In this case, check the dyes selected for each target, then reanalyze the data.
Please review the following possible causes and solutions:
- The baseline was set improperly. This can potentially be corrected by switching from automatic baseline to a manual baseline (or vice versa), and/or increasing the upper or lower value of the baseline range. Please see your real‑time PCR system user guide for procedures on setting the baseline.
- The sample quality was poor. In this case, you can perform a quality check on the sample and then re-extract the sample if needed.
- There were different concentrations caused my imprecise pipetting. To remedy this, please follow accurate pipetting practices.
- The reagents or equipment are contaminated. Please ensure that your workspace and equipment are cleaned properly.
Please review the following possible causes and solutions:
- One or more of the reaction components was not added. Ensure that the cDNA, the assay, and the Master Mix were added to the reaction plate. The passive reference fails if the Master Mix is missing.
- Incorrect dyes were selected for each target. Check the dyes selected for each target, then reanalyze the data.
- The annealing temperature was too high for the primers and/or probe. Ensure that the correct annealing andextension temperatures are set, and that the real-time PCR instrument is calibrated and maintained regularly.
- Inappropriate reaction conditions were used. Ensure that the properties and the thermal protocol are correct, then troubleshoot the real-time PCR optimization.
- The template is degraded. Determine the quality of the template, then rerun the assay with fresh template if needed. We recommend that you use Use RNase-free reagents and an RNase inhibitor.
- Inhibitors are present in the reaction. To check for inhibitors, we recommend that you run a serial dilution of your sample with an expressing assay (for example, an endogenous control). If an inhibitor is present, the high concentration samples yield higher-than-expected Ct values because the sample are not diluted.
- The baseline and/or threshold was improperly set. This issue can potentially be resolved by switching from an automatic baseline to a manual baseline (or vice versa), and/or lowering the threshold value to fall within the appropriate range.
Please see your real-time PCR system user guide for procedures on setting the baseline and threshold.
- The reverse transcription failed. We recommend checking the RNA integrity and concentration, checking for RNase activity, following the recommended thermal profile, and/or repeating the reverse transcription using new reagents.
- (Custom TaqMan Small RNA Assays only) The design or synthesis of the custom assay failed. Ensure that the sequence you submitted is correct, and check for an alternative trascript or splice variant.
Most likely there is little or no Master Mix present in the reaction due to inaccurate pipetting. Please follow accurate pipetting practices when setting up reactions.
The sequence provided for the assay design may contain mismatches with sample sequences. We recommend that you perform bioinformatics analysis for assay design.
For more information, see the Custom TaqMan Small RNA Assays Design and Ordering Guide (Pub.No. 4412550).
There may be interaction between the primer and probe. We recommend that you adjust the threshold manually, or select another assay from the same gene, if available.
Here are some possible causes and solutions:
- The baseline was set too high and some samples have Ct values lower than the baseline stop value. In this case, we recommend switching from manual to automatic baselining, or move the baseline stop value to a lower Ct. The baseline stop value should be set to a Ct 2 cycles before the amplification curve crosses the threshold. Please see your real‑time PCR system user guide for procedures on setting the baseline.
- No baseline can be set because the amplification signal is detected too early in the PCR cycles. Diluting the sample will increase the Ct value.
Amplification in the negative control well indicates that the reagents or the cDNA template are contaminated. Please follow established PCR good laboratory practices to prevent contamination.
Poor reproducibility across technical replicates indicates that the reagents were not adequately mixed. Please ensure that all samples and reagents are mixed well.
The Ct value for the NTC can be <35 for the following reasons:
- There are non-specific interactions between primers. For NTC information on a specific assay, see the Megaplex Assay Performance File.
- The cDNA template is contaminated. Follow established PCR good laboratory practices to prevent contamination.