TaqMan™ MicroRNA Assay, S (50 RT/150 PCR reactions), Inventoried - FAQs

TaqMan™ MicroRNA Assay, S (50 RT/150 PCR reactions), Inventoried - FAQs

View additional product information for TaqMan™ MicroRNA Assay - FAQs (4427975, 4440887, 4440886, 4440885, 4440888)

71 product FAQs found

What are the performance specifications of the TaqMan miRNA assays?

The TaqMan miRNA asays are guaranteed to meet the following:
Dynamic Range: > 6 logs10 with > 0.97 linearity (R2 value)
Specificity: Majority of assays have < 5% cross reactivity with closely related sequences. NTC background: Ct > 38.0
Lot-to-Lot Reproducibility: Difference between Ct's < 0.6 Ct when different lots of an assay are run with the same sample and master mix from the same lot on the sample plate
Amplification Efficiency: ranging from 90-110% across 5 logs10

Please see the document “TaqMan Assays QPCR Guarantee Program” for more details.

What data analysis tools do you recommend?

If you are using an Applied Biosystems instrument, we recommend using Expression Suite to analyze data from the TaqMan MicroRNA Array Cards. After importing the .sds or .eds files, you can perform all the QC and data analysis within the tool. For more details on how to use Expression Suite software, please see this video series: https://learn.thermofisher.com/courses/view/id/325

Do you have data to back up your claim that your TaqMan MicroRNA Assays can accurately distinguish miRNA targets that differ by a single base? Have you tested each TaqMan MicroRNA Assay that is designed to one of two or more closely-related target sequences?

It is well understood within the miRNA community that designing assays for miRNAs is challenging due to their short length (<22 bases) and closely related sequences. Although we have not tested cross reactivity of every closely related species, we have demonstrated that we can achieve <5% cross reactivity between a single nucleotide mismatch. Specificity of an assay depends on the number of mismatches to its closest homologue, the location of the mismatch, and the surrounding bases, making cross reactivity difficult to predict. As a general rule, the most difficult miRNA targets to discriminate are those with minimal mismatches localized to the 5' region of the sequence, and it is close to impossible to design an assay that discriminates between a single mismatch at the 5' most base. In addition, the assays in our catalog have been designed to provide a balance between specificity and sensitivity: an assay may be very specific but lack the needed sensitivity, or vice versa. To achieve this balance, and to ensure the highest sensitivity and to reduce false positives, TaqMan MicroRNA Assays must have an NTC background Ct > 38.0 and display good linearity across at least 3 logs10 (ideal R2 > 0.98).

What about isomiRs? Will Thermo Fisher Scientific assays give me good quantification if they only detect one isomer and not all of them?

Deep sequencing analysis of mature miRNAs revealed that many miRNAs have either an addition or deletion of 1-3 bases at the 3' and less frequently at the 5' terminal end. These are often referred to as isomiRs. The sequence deposited in miRBase is the canonical sequence derived by aligning sequences from current deep sequencing data. Thus far, there has been no biological relevance attached to these different forms since they exclusively occur outside the seed sequence. For that reason, the changes detected in the expression level of one isomer are proportional to changes within the entire pool. As a result, there may be a shift in raw Ct value using assays targeting two separate isomiRs. However, the relative expression ddCt has been demonstrated to be roughly the same. It should be noted that, although TaqMan MicroRNA Assays are designed to be sequence specific, they will detect a small spectrum of isomiRs. Depending on the number and composition at the 3' end, an assay may detect the +1 and +2 isomiRs but not the -1 or -2 forms.

What I can do to minimize variability when using assays?

Use multiple replicates and consider, when possible, using an overall study control that is used in every assay to monitor potential day-to-day/run-to-run/across study variability.

How are my results going to be affected by using assays of different manufacturing lots?

TaqMan MicroRNA Assays provide excellent lot-to-lot reproducibility, with a maximum deviation range of 0.5 Ct's between different lots. We advise running a control sample with both lots in parallel to ensure continuity in your experiments.

What are the different packaging options for TaqMan MicroRNA Assays?

The TaqMan miRNA assays are available in: Extra Small (XS) Small (S) Medium (M) Large (L).

Do I have to use the Universal Master Mix with my TaqMan MicroRNA Assays? If so, which one?

Yes. This is the recommended master mix for TaqMan MicroRNA Assays. You can use Universal Master Mix or Universal Master Mix II (with or without UNG). You can also use the Fast Advanced Master Mix.

Can I run preamp with individual TaqMan MicroRNA Assays?

Yes. Refer to Protocol for Creating Custom RT and Preamplification Pools using TaqMan MicroRNA Assays (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/4465407_CustomRT-preamp_UG.pdf) for detailed information. When pooling fewer than 12 assays together, you can reduce the final volume but keep the final concentration of each assay in the pool at 0.2X (i.e. by diluting each 20X TaqMan MicroRNA Assay 1:100X)

Pre-amplification was developed for use with small sample size as a means to “stretch” your sample. At the same time, the variability of the Ct value is reduced for low copy number transcripts.

Is it possible to combine several miRNA RT primers together for reverse transcription, and if so, how?

Yes. If you are using individual TaqMan MicroRNA Assays, you can prepare your own RT and PreAmp pools. Refer to Protocol for Creating Custom RT and Preamplification Pools using TaqMan MicroRNA Assays (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/4465407_CustomRT-preamp_UG.pdf) for detailed information. Although this protocol has been tested by our development group, we recommend that you validate the performance of the particular pool that you are interested in working with. At a minimum, we recommend running a No Template Control (NTC). The NTC is crucial to identify any primer interactions that may increase the background.

For miRNA studies, what is the best way to normalize results?

Selecting a good endogenous control is imperative for good data normalization; see details in our Application Note by searching for “Endogenous Controls for Real-Time Quantitation of miRNA Using TaqMan MicroRNA Assays”. For a large number of targets (e.g., beyond 380), you can use the Global Mean Normalization method (Mestdagh et al. 2009 Genome Biology, http://genomebiology.com/2009/10/6/R64). ExpressionSuite, a free gene expression data analysis tool, provides global normalization when using large number of samples. It also provides the selection of single or multiple endogenous controls. You can download ExpressionSuite for free from our Technical Resources page under “Software, Patches, and Updates”.

When are spike-ins recommended for miRNA studies? How do you use one?

Spike-ins or exogenous controls are recommended when it is necessary to monitor for extraction efficiency or sample input amount with difficult samples (for example with serum/plasma, other biofluids). A spike in control should be a target sequence that is not present in your sample. For example, ath-miR-159a is not present in humans so is a good spike in control for human. Exogenous controls are synthetic RNA oligonucleotides that match the target sequence. The RNA oligo does not require a 5' phosphate and HPLC purification is not necessary. We recommend using 5-10 pM for each spike in control. We have TaqMan MicroRNA Assays available for a number of miRNAs that can be used as spike in controls with human samples (ath-miR-159a; cel-miR-39-3p cel-miR-2-3p).

What is the expected Ct value of U6 in my sample?

As with any other targets, the particular Ct value will depend on multiple factors, such as the tissue type and its condition, the input amount of RNA, the sample preparation method, etc. In the tissue samples we have looked at the U6 is moderately expressed.

What endogenous control to use for human miRNA from blood (serum, plasma)?

Small RNAs such as snRNAs or snoRNAs are usually not present in serum or other body fluids. Spike in controls can be used to monitor sample preparation. Any miRNA that is present in your serum samples can be used as a control as long as it is stably expressed across all the sample types in your study. You can refer to the literature for candidate miRNAs to test or you can select of a control from your data set to use in your analysis.

What endogenous control should I use for non-human and non-mouse miRNA assays?

It is important to select the appropriate endogenous control to normalize your data. Thermo Fisher Scientific has identified a number of small non-coding RNAs (snoRNAs, snRNAs) that show stable, moderate expression across a large number of tissues for human and mouse that are therefore good candidates for an endogenous control. Candidate controls are also available for rat, Drosophila, Arabidopsis and C. elegans. An updated list of available controls can be found on our portal (www.thermofisher.com/taqmanmirna) by selecting MicroRNA and then Controls, followed by the species of interest as search options.

In general, any miRNA can be used as an endogenous control to normalize results across different samples as long as it meets the criteria of a good endogenous control: providing stable expression levels with minimal variation across the different sample and conditions being used in your study. Since a control for one experimental study/treatment may not be appropriate for another one, a control should be validated before use. One approach is to select the control(s) based on your data set. An Application Note that describes how to perform validation using simple statistical methods, i.e., by measuring the Standard Deviation of the average Ct, is available: Endogenous Controls for Real-Time Quantitation of miRNA Using TaqMan MicroRNA Assays (http://tools.thermofisher.com/content/sfs/brochures/cms_044972.pdf). Alternatively, you can use geNorm (Vandensompele et al. 2002 Genome Biology, http://genomebiology.com/2002/3/7/research/0034) to determine which of the candidate controls is best to use for your study.

I searched with the Assay Name and the search returned two different assays: Which one should I order?

Searching by sequence of a given miRNA is the most accurate way to ensure finding the right assay for that particular miRNA. In some cases, when searching by Assay Name, multiple assays are found bearing that Assay name. Two different assays may have the same Assay Name when miRBase modifies the sequence of an existing miRNA but retains the same miRNA ID as the old one for the new sequence. As an example, Assay 000385 was designed to target hsa-miR-1, the human miR-1 introduced with miRBase v2.0, and assigned “hsa-miR-1” as the Assay Name to reflect the annotation in miRBase. When the sequence for the human miR-1 was changed in a later release of miRBase (v10.1), Assay 002222 was designed to target the new sequence. As a result, both assays are named “hsa-miR-1” in alignment with miRBase. Due to the change in sequence for human, Assay 000385 no longer maps to the human miRNA. However, this assay still targets the miR-1 in all those species whose sequence has not changed since miRBase 2.0

What is the best way to search for a TaqMan MicroRNA Assay?

Because of the potential instability of miRBase, names can sometimes be misleading; therefore searching by miRNA sequence is the most accurate method to search for an assay.

I have found more than one assay for my query. How do I know which one is the right assay?

Check the target sequence listed in the search details to ensure it corresponds to your needs. If you are not sure about the sequence of your miRNA of interest, first verify it by looking up the associated miRNA on miRBase.org and reviewing the reference information to make sure you select the correct miRNA.

How do I search for a TaqMan MicroRNA Assay on the Thermo Fisher Scientific website?

Go to the URL: www.thermofisher.com/taqmanmirna
1. Select MicroRNA under “What type of experiment are you conducting”?
2. Select Mature miRNA under “What type of miRNA are you interested in”?
3. Select the name of the Species that the assay needs to target.
4. Specify the assay or the mature miRNA targeted by entering one of the following pieces of information: Assay ID, miRBase ID, Accession #, or miRNA target sequence.
If the search returns a large number of results, these can be narrowed with the filters in the left hand of the screen, e.g.: by selecting for Inventoried Assays only, or by selecting specific species.

You can also check out this short video on how to search for an assay:
http://www.youtube.com/watch?feature=player_embedded&v=kbYa0hsglD8

How come the annotation of some TaqMan miRNA assays on the portal show only blanks?

An assay would lose its annotation when it no longer maps to an annotated miRNA (i.e. the miRNA was removed from miRBase); as a result, the annotation fields on the website are empty. For example, the sequence UGUAAACAUCCUUGACUGGA was last mapped to hsa-miR-30e-5p in miRBase v9.2. It has since been removed from the database and replaced with a sequence that is 2 bases longer at the 3' end: UGUAAACAUCCUUGACUGGAAG.

What is the "alias" associated with the TaqMan miRNA assays?

An alias is the miRBAse ID for a given miRNA from an earlier version. Alias information is found in the Details section of the search results. The miRBase release version shown in parentheses represents when the alias miRBase ID was last listed.

Why is an assay for human named with the name of another species?

An assay for a human miRNA may have a lower species name because the target sequence was first introduced and published in miRBase for that species and only later found in human. For example, mmu-miR-124a was first introduced as a mouse miRNA. The human miRNA was introduced later.

How are the assays named when the same sequence is common across multiple species?

When a sequence that maps to multiple species is introduced into miRBase, the assay name is given according to the following hierarchy: hsa, mmu, rno, dre, cel, ath, and then alphabetically for the remaining species. Thus if an assay maps to human, mouse and c. elegans simultaneously, it will be named hsa-miR-nnn.

How are the assay IDs for TaqMan miRNA assays assigned?

TaqMan MicroRNA Assays are given a unique and invariable Assay ID. The Assay ID, as well as the assay design, i.e. the sequences of the oligos composing the assay (RT, forward and reverse primers, and TaqMan probe), do not change. The Assay Name is the miRBase ID for the targeted miRNA sequence when the assay was first released. miRBase IDs are known to be unstable as there have been multiple changes over time: Annotation changes include revised miRNA sequences for the same miRBase ID, and updated miRBase IDs. Thus, a sequence may have a different miRNA ID from the one it originally had, or a given miRNA ID may have a modified sequence. The assay, however, is still completely functional for the sequence for which it was originally designed. It is always recommended to use the miRNA sequence or miRBase Accession Number to confirm that a given assay will target a specific miRNA.

What is the miRBAse accession number?

Accession numbers are unique identifiers assigned to both hairpin (e.g.: MI0000015) and mature (e.g.: MIMAT0000029) sequences. While miRBase names may change, the accession numbers are stable and remain associated with a specific sequence.

What is the miRBase ID?

The mirBase ID is the official miRBase name given to a mature miRNA sequence. There may be multiple miRBase IDs for a given mature miRNA sequence because many miRNAs are conserved across species (for example, several hundred human miRNAs have the identical sequence in common with the mouse species). The miRBase ID consist of a 3 letter species identifier, including the first letter of the genus and the first two letters of the species, followed by the expression “miR”, and then a numeric suffix, e.g.: hsa-miR-212. Since two distinct mature miRNAs can be derived from the different arms of the same stem-loop precursor, a -5p or -3p suffix specifies the particular arm of the stem from which they come, e.g.: hsa-miR-501-5p is derived from the 5' end of the stem, while hsa-miR-501-3p is derived from the 3' end. The miRNA gene and hairpin precursor locus name is given lower case: hsa-mir-212. If a mature miRNA is predicted to be expressed from more than one hairpin precursor, then a numeric suffix is added to the precursor name. For example, hsa-miR-101 is expressed from two precursor loci, hsa-mir-101-1 and hsa-mir-101-2. Closely related miRNAs are given lettered suffixes (hsa-miR-19a-3p and hsa-miR-19b-3p) and are expressed from similarly named precursors (hsa-mir-19a-3p and hsa-mir-19b-3p).

miRBase continues to re-annotate the miRNA sequences as more information becomes available. Updated versions of miRBase are released on a regular basis. At the time of print (June 2013), it was up to v20.

What type of sample can be used with TaqMan MicroRNA Assays?

One to ten nanograms of total RNA per 15 µL RT reaction is recommended for use with the TaqMan MicroRNA Assay. We have successfully detected miRNAs in as little as 25 pg of total RNA (~100 cells) in samples where the miRNA was highly abundant. The total RNA isolation procedure used must preserve small RNA species. We recommend the Invitrogen mirVana miRNA Isolation Kit (Cat. No. AM1560) or TRI reagent (Cat. No. AM9738).

How are the TaqMan MicroRNA Assays validated?

The initial designs were functionally tested with a pool of commercially available RNAs (or artificial mRNA template) over four RNA concentrations. Each assay passed a test for linearity and NTC. All subsequenct designs are tested for NTC.

What number of RT reactions and TaqMan reactions are in the different packaging options?

Here are the assay sizes and the number of reactions (RT) and (PCR), respectively:
Extra Small (XS): RT 25, PCR 75
Small (S): RT 50, PCR 150
Medium (M): RT 750, PCR 750
Large (L): RT 2900, PCR 2900

What species do the TaqMan MicroRNA Assays detect?

Our Content is now aligned with release 20 of the miRBase database and provides comprehensive coverage for the 206 species listed. For the most up to date content, use our MicroRNA Assay Search Tool at www.thermofisher.com/taqmanmirna

What TaqMan MicroRNA Assays are available to use as endogenous controls?

Currently the only species for which there are endogenous controls available are human and mouse. However, within the experimental study, a researcher may be able to identify a microRNA that remains constant across their samples and use that as the endogenous control. More TaqMan miRNA assays are released regularly, so please check the Thermo Fisher Scientific website for new assays.

Human TaqMan miRNA endogenous controls currently available include: miRNA for tissues: hsa-miR-26b, hsa-miR-92, hsa-miR-92N; miRNA for cell lines: hsa-miR-423, hsa-miR-374, hsa-miR-16; sn/snoRNAs: RNU48, RNU44, U47, RNU6B, or all four.

Mouse TaqMan miRNA endogenous controls currently available include: snoRNA202, snoRNA234, or both.

What is the mechanism for microRNA- and siRNA-mediated RNA interference?

RNA interference has evolved to describe the process for repressing or silencing gene expression. Whether the small RNA that triggers the event is of an endogenous (miRNA) or exogenous (siRNA/shRNA) origin, the mechanism is similar. The RNA interference pathway (RNAi) is a process in which a double-stranded RNA (dsRNA) triggers the degradation of a homologous mRNA. An enzyme called Dicer cleaves the dsRNA into small duplexes of 21-25 nucleotides. The siRNAs are combined into a multi-protein complex called RISC (RNA-induced silencing complex), and the RISC is guided to mRNAs that have perfect homology with the siRNAs, targeting them for sequence-specific degradation. MicroRNAs are thought to be processed by the same cellular mechanism as the RNAi pathway including Dicer and the RISC complex. RNAi has become a tool to study gene function by blocking the expression of specific mRNAs and generating “knockdowns” (reverse genetics).

What are the differences between microRNA and siRNA?

MicroRNAs (miRNAs) are endogenous non-coding RNAs, approximately 22 nucleotides in length, that play an important role in post-transcriptional gene regulation in animals and plants by targeting messenger RNA (mRNA) for degradation or translational repression. Small interfering RNA (siRNA), known as short interfering RNA or silencing RNA, are a class of 20-25 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology. Both miRNA and siRNA are involved in regulation of gene expression.

What salt concentration for Power SYBR Green Master mix should be used in primer design?

A total salt concentration value of 60 mM at 1X concentration of the master mix can be used when designing primers for SYBR Green Reagent based assays.

What does it mean when there is a asterisk sign (*) after the name of a particular TaqMan MicroRNA Assay?

Earlier naming convention used the miR/miR* (a.k.a. “non-star/star”) nomenclature to identify the mature miRNA that was predominantly expressed from a precursor stem loop. This nomenclature has been phased out and replaced with -5p/-3p in miRBase. Thermo Fisher Scientific continues to use the “star” in the Assay Names for those assays that were released when the “star” convention was in use by miRBase.

What methods should I use for miRNA expression analysis?

The comparative Ct method is recommended. See the Guide to Performing Relative Quantitation of Gene Expression Using Real-Time Quantitative PCR, available at www.thermofisher.com (search for Cat. No. 4371095)

What does it mean when a miRNA target entry has been removed (obsoleted) from miRBase?

miRBase continues to re-annotate the miRNA sequences as more information becomes available. A sequence that once mapped to a given species (e.g.: human) may no longer exist, so it is removed from miRBase. Accordingly, the original assay for that sequence no longer maps to an annotated miRNA, and as a result the annotation fields on the search results page on the Thermo Fisher Scientific portal are empty. An example of this is Assay “hsa-miR-505” (Assay ID 001049). miRBase continues to re-annotate the miRNA sequences as more information becomes available. A sequence that once mapped to a given species (e.g.: human) may no longer exist, so it is removed from miRBase. Accordingly, the original assay for that sequence no longer maps to an annotated miRNA, and as a result the annotation fields on the search results page on the Thermo Fisher Scientific portal are empty. An example of this is Assay “hsa-miR-505” (Assay ID 001049).

How specific are TaqMan microRNA Assays?

TaqMan MicroRNA Assays are highly specific. The assays are designed to detect mature miRNA sequences and can distinguish between the mature miRNA and its precursor. In addition, these assays can often distinguish between miRNA targets that differ by only a single nucleotide.

Is there a difference between theTaqMan Gene Expression Assays and TaqMan miRNA Assays?

The specific TaqMan miRNA Assay consists of the reverse and forward primers and TaqMan FAM-MGB fluorescent dye-labeled probe at a 20X concentration. It also includes a separate miRNA-specific reverse transcription (RT) primer. The TaqMan miRNA Assays are designed using a miRNA design process and are not designed through the TaqMan Gene Expression Assay pipeline. The primer and probe concentrations have been optimized for miRNA amplification and are different from the TaqMan Gene Expression Assays. The assays are performed using universal cycling conditions on any Applied Biosystems Real-Time PCR instrument system. For more detailed information please consult the TaqMan MicroRNA Assays Protocol.

What is the TaqMan MicroRNA Assay?

A TaqMan MicroRNA Assay has two components: an RT reaction containing a miRNA specific stem-loop reverse-transcription primer and a separate specific TaqMan miRNA Assay. The RT stem-loop primer provides the specificity for the mature miRNA target; it does not detect its precursor. The formation of a RT primer/mature miRNA-chimera extends the length of the 5’ end of the miRNA. The longer RT product provides a miRNA specific cDNA template amenable to the TaqMan assay design.

Where can I find cross species information for TaqMan MicroRNA Assays?

Cross species information is listed in http://www.mirbase.org. It can also be found in the miRNA Assay Index File which can be downloaded from http://www.appliedbiosystems.com/support/miRNA_aif.xls.

Are miRNAs species specific?

MicroRNAs are highly conserved across species; ~70% of human miRNAs are identical in sequence with miRNAs from other species. This high degree of sequence conservation across distantly related organisms suggest that miRNAs participate in a wide variety of essential biological processes.

What is mechanism of the TaqMan MicroRNA Assays?

There are 2 steps involved in using the TaqMan MicroRNA Assays:

1. RT step: total RNA to cDNA using miRNA-specific RT primers from the TaqMan MicroRNA Assays and the TaqMan MicroRNA Reverse Transcription Kit (P/N 4366596, 200 reactions or 4366597, 1000 reactions)

2. PCR step: cDNA to PCR products using primers and probe from the TaqMan MicroRNA Assays together with TaqMan Universal PCR Master Mix No AmpErase UNG (P/N 4324018).

What is the average size of an amplicon generated using TaqMan MicroRNA Assays?

The average amplicon size for a TaqMan MicroRNA Assay is less than 75 bp.

Why are miRNAs so important?

MicroRNAs are believed to play an important role in post transcriptional gene regulation. A total of ~850 unique miRNAs have been discovered so far, including ~333 human miRNAs. They are relatively abundant, ranging from a few to as many as 50,000 molecules per cell. They account for approximately 1% of the predicted genes in animals and plants. The level of individual miRNAs varies dramatically across cell type and developmental stages. These differences in miRNA level are believed to be a key indicator of miRNA activity.

Recent research has implicated miRNAs in the following: cell development, differentiation, communication and cell death; DNA methylation and chromatin modification; metabolism; human cancer development; haematopoiesis; nervous system patterning; insulin secretion.

What are miRNAs?

MicroRNAs (miRNAs) are endogenous non-coding RNAs, about 22 nucleotides in length, that play an important role in post-transcriptional gene regulation in animals and plants by targeting messenger RNA (mRNA) for degradation or translational repression. The miRNA precursors are transcribed from individual genes but are not translated into proteins. The primary transcript is processed in the nucleus to give one or more hairpin precursors that is exported to the cytoplasm. The mature miRNA is excised from the hairpin precursor. The mature miRNA is the biologically active form and regulates the expression of mRNA transcripts by binding to complementary sites on target mRNAs and inhibiting translation or, when there is perfect complementarity to the target sequence, inducing mRNA cleavage. In animals, translational repression, not transcript degradation, is the dominant miRNA mode of action.

What dye and quencher are used by predesigned TaqMan Advanced miRNA assays/ and TaqMan MicroRNA Assays?

Both assays use, by default, FAM as a dye and NFQ-MGB as a quencher.

The TaqMan MicroRNA Reverse Transcription Kit (Cat. No. 4366596) does not include the 5x RT primer mentioned in the protocol. How do I perform reverse transcription?

The 5x RT primer is specific for the miRNA for which you have purchased the TaqMan MicroRNA assay. The 5x RT primers do not come with the above reverse transcription kit, rather with the TaqMan MicroRNA Assay (Cat. No. 4427975). This product includes the following components:
  • 1 tube containing RT primer at concentration of 5X (XS and S sizes), 20X (M size), or 60X (L size)
  • 1 tube containing a 20X (XS, S, and M sizes) or 60X (L size) mix of pre-formulated assay (1 probe and 2 primers).
TaqMan Primers and Probes

Find additional tips, troubleshooting help, and resources within our TaqMan Primers and Probes Support Center.

In a TaqMan miRNA Assay analysis using QuantStudio 3 and analyzing the data on the Thermo Fisher Connect, some of the samples have some flags (! and RGO). What do these flags mean?

The exclamation mark means HIGHSD (high Standard Deviation in replicate group). The RGO flag in cloud software is the same as OUTLIERRG quality flag. This quality flag indicates that the Cq for the well deviates significantly from values in the associated replicate group. For a detailed explanation of the quality flags, see here.

Find additional tips, troubleshooting help, and resources within our QuantStudio 3 and QuantStudio 5 Real Time PCR Systems Support Center

Why can I not detect any miRNA in my sample using the TaqMan MicroRNA Assay?

Most likely, the threshold is set too high to detect miRNA in samples with low levels of expression. We recommend adjusting the threshold (Ct) or NOAMP flag threshold (Crt) to an appropriate level.

Why is there is a noisy signal above the threshold for my TaqMan Small RNA Assay?

Please review the following possible causes and solutions:
-The sample evaporated. Check the seal of the adhesive film for leaks.
- The well is empty because of inaccurate pipetting. Check the calibration of the pipettes, and pipette at least 5 µL of sample.
- The well is assigned a sample or target in the plate document or experiment, but the well is empty. Ensure that the plate document or experiment is set up correctly. Try excluding the well, then reanalyzing the data.

There was a small ΔRn for samples in my TaqMan Small RNA Assay?

A small ΔRn can mean that the PCR efficiency was poor. Ensure that the reagents were used at the correct concentration. Alternatively, the quantity of the cDNA may be low (a low copy number of the target). In this case, we recommend that you increase the quantity of the cDNA in the reaction.

Why did the Rn value shift during the early PCR cycles (cycles 0 to 5) for my TaqMan Small RNA Assay?

Most likely the fluorescence did not stabilize to the buffer conditions of the reaction mix.
Note: This condition does not affect PCR or the final results.
We recommend that you try the following possible solutions:
- Reset the lower value of the baseline range.
- Use an automatic baseline.
- Use the relative threshold algorithm (Crt). See Introduction to Gene Expression Getting Started Guide (Pub. No. 4454239).

Why did amplification occur in the no-RT control for my TaqMan Small RNA Assay?

Amplification in the no-RT control can be due to the cDNA template or amplicon being contaminated. Please follow established PCR good laboratory practices.

Why is the Ct value, for samples in my TaqMan Small RNA Assay, lower than expected?

Please review the following possible causes and solutions:
- Contamination occurred. We recommend that you run no-RT control to confirm that there was genomic DNA (gDNA) contamination. We also recommend the use DNase to ensure minimal gDNA contamination of the RNA.
- Too much cDNA template was added to the reaction. We recommend that you quantitate the RNA before the reverse transcription (RT) reaction. After the RT reaction, adjust the concentration of cDNA before adding it to the reaction.
- The cDNA template or the amplicon is contaminated. Follow established PCR good laboratory practices.

Why are the results for my TaqMan Small RNA Assay inconsistent (high standard deviation in the replicates, inconsistent data, or a variable Ct)?

Please review the following possible causes and solutions:
- The reagents were not mixed properly. Increase the length of time that you mix the reagents. We recommend that you confirm your mixing process by running a replicate assay.
- Pipetting was inaccurate. We recommend that you check the pipette calibration, and pipet at least 5 µL of sample to prepare the reaction mix.
- The threshold was not set correctly. Set the threshold above the noise level and where the replicates are tightest. See your real‑time PCR system user documentation for more information about setting the threshold.
- There was a low concentration of the target of interest. Rerun the assay with more cDNA template.
- Ct is not the most appropriate analysis for the data. We recommend that you try using relative threshold (Crt) analysis. See Introduction to Gene Expression Getting Started Guide (Pub. No. 4454239).

Why do the endogenous control Ct values vary and/or do not normalize the sample well in my TaqMan Small RNA Assay?

Please review the following possible causes and solutions:
- The endogenous control is not consistently expressed across the samples. Ensure that the endogenous control is consistently expressed in your sample type. We recommend that you use an alternative endogenous control such as a nonvariable miRNA.
- The sample concentrations vary. We recommend that you quantify and normalize the PCR samples before running the assay.
- Pipetting was inaccurate. We recommend that you check the pipette calibration, and pipet at least 5 µL of sample to prepare the reaction mix.

Why does the no-template control (NTC) for my TaqMan Small RNA Assay show amplification?

It is possible that the reagents are contaminated with amplicons. We recommend that you clean your workspace and equipment, then rerun the assay using new reagents. We also recommend that you run no-RT controls to rule out genomic DNA contamination, and treat the sample with DNase.

Why is the Rn in the Rn vs.Cycle plot so high for my TaqMan Small RNA Assay?

Most likely the ROX dye was not set as the passive reference. Set ROX dye as the passive reference, then reanalyze the data.

Why is the multicomponent signal for ROX dye not flat for my TaqMan Small RNA Assay?

This can be caused by incorrect dyes selected for each target. Check the dyes selected for each target, then reanalyze the data.

Why was there a simultaneous increase in fluorescence from both the passive reference dye (ROX dye) and the reporter dyes for my TaqMan Small RNA Assay?

This is most likely due to the sample evaporating. We recommend that you check the seal of the adhesive film for leaks before running the plate on the real-time PCR instrument.

Why was there a decrease in ROX dye fluorescence (passive reference dye) in my TaqMan Small RNA Assay?

Please review the following possible causes and solutions:
- Precipitation present in the buffers. Before preparing reactions, please make sure that you mix the Master Mix thoroughly to produce a homogenous solution.
- Reagents are degraded. Ensure that the kits and reagents have been stored according to the instructions on the packaging and that they have not expired.

Why does the amplification curve show no amplification of the sample (Ct=40) in the TaqMan Small RNA Assay?

Please review the following possible causes and solutions:
- The sample does not have enough copies of the target RNA. To confirm the results, we recommend that you rerun the sample using the same assay and/or rerun the assay using more of the sample. Also avoid PCR reaction mix with more than 20% from the reverse transcription reaction.
Note: If the recommended actions do not resolve the problem, the result may be correct.
- One or more of the reaction components was not added. We recommend checking your pipetting equipment and/or technique.
- Incorrect dyes were selected for each target. In this case, check the dyes selected for each target, then reanalyze the data.

Why are the amplification curves shaped differently for different samples with the same TaqMan Small RNA Assay?

Please review the following possible causes and solutions:
- The baseline was set improperly. This can potentially be corrected by switching from automatic baseline to a manual baseline (or vice versa), and/or increasing the upper or lower value of the baseline range. Please see your real‑time PCR system user guide for procedures on setting the baseline.
- The sample quality was poor. In this case, you can perform a quality check on the sample and then re-extract the sample if needed.
- There were different concentrations caused my imprecise pipetting. To remedy this, please follow accurate pipetting practices.
- The reagents or equipment are contaminated. Please ensure that your workspace and equipment are cleaned properly.

Why does the amplification curve show no amplification of the sample (Ct=40) across all TaqMan Small RNA Assays or in an unusually large number of assays?

Please review the following possible causes and solutions:
- One or more of the reaction components was not added. Ensure that the cDNA, the assay, and the Master Mix were added to the reaction plate. The passive reference fails if the Master Mix is missing.

- Incorrect dyes were selected for each target. Check the dyes selected for each target, then reanalyze the data.

- The annealing temperature was too high for the primers and/or probe. Ensure that the correct annealing andextension temperatures are set, and that the real-time PCR instrument is calibrated and maintained regularly.

- Inappropriate reaction conditions were used. Ensure that the properties and the thermal protocol are correct, then troubleshoot the real-time PCR optimization.

- The template is degraded. Determine the quality of the template, then rerun the assay with fresh template if needed. We recommend that you use Use RNase-free reagents and an RNase inhibitor.

- Inhibitors are present in the reaction. To check for inhibitors, we recommend that you run a serial dilution of your sample with an expressing assay (for example, an endogenous control). If an inhibitor is present, the high concentration samples yield higher-than-expected Ct values because the sample are not diluted.

- The baseline and/or threshold was improperly set. This issue can potentially be resolved by switching from an automatic baseline to a manual baseline (or vice versa), and/or lowering the threshold value to fall within the appropriate range.
Please see your real-time PCR system user guide for procedures on setting the baseline and threshold.

- The reverse transcription failed. We recommend checking the RNA integrity and concentration, checking for RNase activity, following the recommended thermal profile, and/or repeating the reverse transcription using new reagents.

- (Custom TaqMan Small RNA Assays only) The design or synthesis of the custom assay failed. Ensure that the sequence you submitted is correct, and check for an alternative trascript or splice variant.

Why does the multicomponent plot show low levels of ROX dye (passive reference dye) in the Taqman Small RNA Assay?

Most likely there is little or no Master Mix present in the reaction due to inaccurate pipetting. Please follow accurate pipetting practices when setting up reactions.

Why does the amplification curve show a rising baseline for samples in my TaqMan Small RNA Assay?

There may be interaction between the primer and probe. We recommend that you adjust the threshold manually, or select another assay from the same gene, if available.

Why does the amplification curve show an abnormal plot and/or low ΔRn values for samples in my TaqMan Small RNA Assay?

Here are some possible causes and solutions:
- The baseline was set too high and some samples have Ct values lower than the baseline stop value. In this case, we recommend switching from manual to automatic baselining, or move the baseline stop value to a lower Ct. The baseline stop value should be set to a Ct 2 cycles before the amplification curve crosses the threshold. Please see your real‑time PCR system user guide for procedures on setting the baseline.
- No baseline can be set because the amplification signal is detected too early in the PCR cycles. Diluting the sample will increase the Ct value.

Why is there amplification in the negative control well for my TaqMan Small RNA Assay?

Amplification in the negative control well indicates that the reagents or the cDNA template are contaminated. Please follow established PCR good laboratory practices to prevent contamination.

Why is there poor reproducibility across technical replicates for my TaqMan Small RNA Assay?

Poor reproducibility across technical replicates indicates that the reagents were not adequately mixed. Please ensure that all samples and reagents are mixed well.

Why is the Ct value for the no-template control (NTC) <35 for some TaqMan Small RNA Assays?

The Ct value for the NTC can be <35 for the following reasons:
- There are non-specific interactions between primers. For NTC information on a specific assay, see the Megaplex Assay Performance File.
- The cDNA template is contaminated. Follow established PCR good laboratory practices to prevent contamination.