Freedom™ CHO-S™ Kit - FAQs

Freedom™ CHO-S™ Kit - FAQs

View additional product information for Freedom™ CHO-S™ Kit - FAQs (A1369601)

44 product FAQs found

Can MTX be used at concentrations higher than 4 µM to increase protein yield using the OptiCHO Express Kit?

There are a couple of concerns associated with high MTX concentrations. One is the stability of the cell line generated using high MTX concentrations. The other is that it may be amplifying the DFHR gene without amplifying the gene of interest along with it stoichiometrically. We recommend the more conservative approach of 4 µM MTX for amplification.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What level of product quality is seen with the Freedom CHO-S Kit?

After execution and payment for a Commercial Production License, a Cell Line Documentation Package (>200 pages, and specific to the lot of cells purchased), is provided, which includes the entire lineage history of the cells, starting at receipt of the initial vial at Thermo Fisher Scientific through delivery to the purchaser, as well as, all testing reports.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

How can I learn more about commercial licensing of Freedom kits, ExpiCHO-S Cells (cGMP banked), CHO-S Cells (cGMP banked), and CHO DG44 Cells (cGMP banked)?

To inquire about a Commercial Production or Service License, please email: outlicensing@thermofisher.com.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

In the Freedom CHO-S Kit, how should I scale up the clones from 96-well plates to shake flasks?

Please refer to the "Clone Scale-Up and Screening" section on page 42 of the Freedom CHO-S Kit manual (https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2Ffreedom_cho_s_kit_man.pdf).

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Why does the cloning medium used in the Freedom CHO-S Kit contain 6 mM glutamine vs. the 8 mM used in all other formulations?

We observed that 8 mM glutamine compromises cloning efficiency in CD FortiCHO Medium relative to 6 mM.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

With the Freedom CHO-S Kit, how do I know if I have cells in the final dilution for limited dilution cloning?

Assuming that you are diluting to plate 1 cell/well in a 96-well plate, your second-to-last dilution is designed to achieve 1,000 cells/mL, and subsequently, the final dilution would be 200 µL of 1,000 cells/mL + 40 mL of cloning medium to give 5 cells/mL. Plating 200 µL per well generates the desired 1 cell/well plating.
Procedure:
- Using the predicted 1,000 cells/mL dilution, seed 12 wells of a flat-bottom 24-well plate with 8 µL of cells. If the initial cell count and subsequent dilution steps were accurate, you should see ~8 cells/well on average.
- Count the total number of cells in the 12 wells and divide by 96 µL. Multiply by 1,000 to get the cell suspension concentration, and use this corrected value to achieve your desired final dilution.

Example:
- If you count 65 cells in 96 µL, you have 65/96 x 1,000 = 677 cells/mL.
- Using the accurate cell count of 677 cells/mL, your final dilution to achieve 5 cells/mL per 40 mL of cloning medium is:
5 cells/mL x 40 mL/677 cells/mL x 1,000 = 295 µL of 677 cells/mL + 39.7 mL of cloning medium.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

With the Freedom CHO-S Kit, how should I handle stable pools once they are recovered?

A frozen stock of each stable pool should be generated as soon as pools recover from each selection phase. Stable pools should not be passaged without selection pressure. Because of pool drift, it is best to seed stable pools for limited dilution cloning as close to stable pool recovery as possible.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

How long does it take to select for a stable pool using the Freedom CHO-S Kit? How low does cell viability drop?

Phase I selection typically takes 14-18 days, and Phase II selection takes 7-14 days, for a total of 21-32 days. Cell viability in Phase I can drop below 10%; in Phase II, it usually does not drop below 40%. The no-DNA control will drop below 10% beyond the first week in selection, and will help to distinguish true recovery during selection. The no-DNA control does not need to be maintained beyond Phase I selection.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

With the Freedom CHO-S Kit, what titers can I expect after Phase I and Phase II of selection with puromycin and methotrexate?

Although titers will vary depending on the molecule being expressed, in general, titers increase from Phase I to Phase II selection. Typically, Phase I pool titers are in the range of 20-50 mg/L when measured using a 5-day assay, and Phase II pool titers are in the range of 400-800 mg/L when measured on day 14 in a shake flask simple fed-batch assay (glucose-only feeding).

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Do you have any information on gene copy number in CHO-S (cGMP banked) Cells?

Gene copy number in CHO-S (cGMP banked) Cells is significantly lower than that in a DG44 clone with equivalent expression levels of the same molecule.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Using CHO-S (cGMP banked) Cells, how much monoclonal antibody can I expect to be expressed after transfection?

At 2 days post-transfection, we typically obtain 3-9 µg/mL protein in the transfection supernatant.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

How do I strain CHO-S (cGMP banked) Cells?

1. Remove flasks from the incubator. Inspect flasks for cell clumping (that would mandate straining).
2. Use a fresh, sterile 250 mL shake flask. Remove cap (while maintaining sterility) and place a sterile cell strainer on top of the flask.
3. Pipet or pour culture over the strainer.
4. Discard the cell strainer and replace the cap. Proceed with cell counting and passage.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

How do I deal with clumping of CHO-S (cGMP banked) Cells?

Clumping of CHO-S (cGMP banked) Cells is to be expected. There are three ways to minimize cell clumping:
- Remove clumps with a cell strainer beginning at passage 1 post-thaw.
- Avoid cell clumps in both sampling and passage of cells.
- Do not allow cell densities to exceed 2 x 10E6 viable cells/mL pre-transfection.
Note: Do not, however, use Anti-Clumping Agent prior to transfection. Later, inclusion of Anti-Clumping Agent is critical to the success of selection.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What is the origin of CHO-S (cGMP banked) Cells?

CHO-S (cGMP banked) Cells are derived from the CHO line established by Dr. Tobey at the Los Alamos National Laboratory. CHO-S cells are distinguished from the commonly used CHO-K1 cell line based on karyotype (Chromosome 41:129–144 (1973)), and more recently by sequencing analysis (Nature Biotechnol 31:759–765 (2013)).

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What incubator parameters do you use for culturing CHO-S (cGMP banked) Cells?

An Infors Multitron Incubator with a 25 mm throw is used in-house. The incubator parameters used are shown below. If your shaking incubator has a different throw, we recommend that, prior to initiating cell line development, CHO-S cell growth be optimized by adjusting shaker speed based on the following equation:
RCF = 1.118 x 10-5 x throw x rpm2

Temperature: 37 degrees C
CO2 concentration: 8%
Relative humidity: 80%
Agitation: 150 rpm (shake flasks); 130 rpm (shaking well plates)
Platform size: 850 mm x 470 mm
Throw: 25 mm

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Do I need to test my pCHO 1.0 construct if the insert expressed well in another vector?

Successful expression in another cell line and/or vector does not guarantee expression of the protein or secretion when placing sequences in the pCHO 1.0 vector/Freedom CHO-S system. It is highly recommended that pCHO 1.0 constructs be tested by transient transfection in CHO-S (cGMP banked) Cells before proceeding with selection.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Do you have any information about the bacterial origin of replication in the Freedom pCHO 1.0 Vector?

The bacterial origin of replication in pCHO 1.0 vector is derived from the mutated pMB1 ori from pUC19, and confers replication at high copy number.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

How do I check for orientation of my gene of interest in the Freedom pCHO 1.0 Vector after using blunt-end fragment cloning?

The simplest way to check for the orientation of a fragment cloned using blunt-end ligation is to generate an asymmetric cut in the inserted fragment and a single or double cut in the vector. The asymmetric cut in the gene of interest should be close either to the 5' or 3' end of the gene so that the resulting digestion fragment can readily be resolved on an agarose gel to establish the orientation of your gene. As a control, digest the empty vector with the same restriction enzymes.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What sequencing primers can I use to verify my Freedom pCHO 1.0 construct?

We strongly recommend that you analyze your recombinant expression plasmid(s) by sequencing the promoter-gene of interest junctions before transfecting CHO-S cells (cGMP-banked) and expressing your protein(s) of interest. For your convenience, the sequences of the primers used for analyzing the promoter-gene of interest junctions in the recombinant expression plasmid(s) are provided below. Note that the sequencing primers are not supplied as part of the Freedom CHO-S Kit; they need to be ordered separately and custom-synthesized.

SU1-For (Forward primer for EF2/CMV hybrid promoter ORF): GTCTGAGCCTCCTTGTCTTG (Begins ~270 bp upstream of AvrII/BstZ17I insertion site)

SU1-Rev (Reverse primer for EF2/CMV hybrid promoter ORF): AGAAGACACGGGAGACTTAG (Begins ~90 bp downstream of AvrII/BstZ17I insertion site)

SU2-For (Forward primer for CMV/EF1 hybrid promoter ORF): GGTGTCGTGAGGAATTTCAG (Begins ~285 bp upstream of EcoRV/PacI insertion site)

SU2-Rev (Reverse primer for CMV/EF1 hybrid promoter ORF): GAGGCAGCCGGATCATAATC (Begins ~250 bp downstream of EcoRV/PacI insertion site)

Note: Depending on the size of your insert(s), you may also need to order insert-specific primers in order to completely sequence each insert prior to transfection.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What should I include in the insert to express my protein of interest using the Freedom pCHO 1.0 Vector?

Beyond the flanking restriction sites, be sure to include the following:
- Kozak sequence (GCCACC) just upstream of the ATG
- ATG
- Signal peptide
- cDNA sequence of gene of interest
- Stop codon

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What is the exact position of the CMV poly(A) site in the Freedom pCHO 1.0 Vector?

The AvrII (5765)-BstZ17I (5776) cloning site is located just upstream of the CMV poly(A) site. The CMV poly(A) site is located at positions 5,773 - 6,052. The poly(A) site will still be intact and functional after cutting the plasmid with AvrII/BstZ17I.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

In the Freedom pCHO 1.0 Vector, two genes of interest are driven by two respective promoters. Is this better in terms of expression than two genes linked by an internal ribosome entry site and driven by one promoter?

The two promoters in pCHO 1.0 vector have been specifically engineered to be distinct in order to avoid any potential issues with recombination, and to minimize downregulation of the downstream gene despite the fact that both promoters are strong and constitutive. The use of an internal ribosome entry site in pCHO 1.0 vector has not been explored.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

The Freedom CHO-S Kit user guide suggests trying both combinations of subunits (SU1 and SU2) when subcloning two separate subunits. Is this really necessary?

For a two-subunit protein, we recommend creating two expression plasmids, each containing the subunits in a different order (SU1–SU2 or SU2–SU1). We suggest transfecting CHO-S Cells (cGMP-banked) with each plasmid in parallel at least through transient transfection to identify the optimal gene orientation to use.
Note: For monoclonal antibodies, we typically express the heavy chain upstream of the light chain, but we do know that both orientations work.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Is it necessary to include the 5'- and 3'-untranslated regions while cloning into the Freedom pCHO 1.0 Vector, or are they already included?

Untranslated regions are not needed to be added, as the vector supplies all necessary regulatory elements as well as downstream poly(A) sequences.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Is there a size limitation of the total insert for the Freedom pCHO 1.0 Vector? Would a large insert like 3.0 kb insert work?

We have cloned up to 6 kb into the Freedom pCHO 1.0 Vector at the AvrII/BstZ17I insertion site without any issues. Increasing plasmid size, in general, compromises transfection efficiency, and therefore it is possible that a larger insert might compromise transfection efficiency.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What is the risk of contamination (bacterial, mycoplasma, viral) of the Freedom pCHO 1.0 Vector?

We have compiled the following information that leads us to conclude that the risk of contamination of the stock vector is very low:
- The LB medium used to grow E. coli is the only source of animal origin components found in the vector manufacturing workflow. However, the SELECT Peptone 140 (pancreatic digest of casein) used in the formulation of LB comes from New Zealand, Australia, and the United States. These are all countries with very low occurrences of TSE/BSE, and therefore the risk of TSE/BSE contamination from the medium is very low.
- DNA is prepared using a PureLink HiPure plasmid prep kit, which uses a patented anion exchange resin to purify plasmid DNA to a level equivalent to two passes through CsCl gradients. This level of purity equates to an efficient removal of proteins, nonplasmid DNA, and RNA, as well as any intact microorganisms that may still be present following the lysis step.
- The final steps in the workflow require the use of alcohol, including 100% isopropanol and 80% ethanol. The use of these alcohols should kill most microorganisms that may have survived previous purification steps.
- The DNA is prepared using sterile disposable or autoclaved containers, and the final DNA resuspension buffer is also sterile. We strongly recommend that you prepare your DNA (Freedom pCHO 1.0 Vector containing your gene(s) of interest) using aseptic techniques and sterile vessels and buffers.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

NruI is suggested as the vector linearization restriction enzyme for the Freedom pCHO 1.0 vector before stable pool generation. Is this enzyme (methylation-sensitive) compatible with TOP10 E. coli (dam-positive)?

Although TOP10 cells are not dam-negative (DNA produced in these cells can be methylated), we have had no problem digesting the Freedom pCHO plasmid with NruI. PvuI may also be used for vector linearization should NruI linearization be incomplete, or if an NruI site is brought in with your gene(s) of interest.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What are your recommendations to clone inserts into the Freedom pCHO 1.0 vector? Should I include Kozak and signal peptide sequences?

Here are our recommendations:
- Use cDNA for your gene(s) of interest.
- 5'- and 3'-untranslated regions need not be included, as those functionalities are included in the vector.
- Include a Kozak sequence, such as GCCACC, immediately preceding the start codon.
- A signal peptide is required and if the gene(s) of interest does not have one, be sure to engineer it into the N-terminus to allow secretion and easier purification of your desired protein(s).

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Do you offer technical support for the Freedom CHO-S Kit?

Yes. Contact our field-based Process Science Fellows (PSFs) at pd.direct@lifetech.com for technical support.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

How can I learn more about commercial licensing of CHO-S Cells (cGMP banked)?

To inquire about a commercial license, please email: pd.direct@lifetech.com. To read the complete list of FAQs related to licensing, go here (https://www.thermofisher.com/us/en/home/life-science/bioproduction/bp-misc/gibco-freedom/freedom-cho-s-cells-and-freedom-dg44-cells-licensing.html).

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Is there a pull-through royalty on final products or an annual maintenance fee when using the Freedom CHO-S Kit?

No. Only a one-time license fee is required, and it covers the commercialization of an unlimited number of molecules using the CHO-S Cells (cGMP banked).

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

When is a license required for the Freedom CHO-S Kit?

A commercial use license is required prior to the sale of expressed proteins, or when an IND submission is being prepared for first in human clinical studies.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What are some considerations for successful scale-up of CHO-S Cells (cGMP banked)?

In terms of scaling-up from shake flask into a bioreactor, initial experiments indicate that antibody-expressing Freedom CHO-S clones readily scale-up into bioreactor vessels while maintaining growth and titer performance.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

How many transfections are typically required to get high-expressing clones from the Freedom CHO-S Kit?

Only two transfections are recommended.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What transfection methods can be used with the Freedom CHO-S Kit?

FreeStyle MAX Reagent is included in the Freedom CHO-S Kit as the preferred transfection reagent. CHO-S Cells (cGMP banked) are also compatible with the Neon Transfection System (optimization of instrument settings is required).

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What cloning methods can be used with the Freedom CHO-S Kit?

Limiting dilution cloning is recommended with the Freedom CHO-S Kit. An evaluation of cloning in semi-solid medium in combination with ClonePix FL instrument is underway.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What selection system is used in the Freedom CHO-S Kit?

Puromycin in combination with methotrexate (MTX) is used to select for stable pools following transfection with the Freedom pCHO 1.0 vector.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What are the main features of the Freedom pCHO 1.0 vector?

Freedom pCHO 1.0 vector can be used to express 1 or 2 subunits and has both DHFR and Puromycin resistance as selection markers. Note: Kanamycin resistance is used to select for the vector in bacteria.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Does the Freedom CHO-S Kit contain documentation for the CHO-S Cells (cGMP banked)?

A certificate of analysis (COA) demonstrating suitability for research use is available to everyone who purchases CHO-S Cells (cGMP banked) or the Freedom CHO-S Kit. A full documentation package, including the cell line's lineage, history, and cGMP testing results, is offered in conjunction with a commercial use license.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What is included in the Freedom CHO-S Kit?

All major components needed for the development of stable clones are included in the Freedom CHO-S Kit: CHO-S Cells (cGMP banked), vector for cloning one or two genes (Freedom pCHO 1.0 Expression Vector), transfection regent (FreeStyle MAX Reagent), competent cells (One Shot TOP10 Chemically Competent E. coli), serum-free cell culture media (CD FortiCHO Medium and OptiPRO SFM), and other reagents such as Anti-Clumping Agent, Puromycin, and L-glutamine. A complete list of components, including additional materials required but not included, can be found in the Freedom CHO-S Kit manual (https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2Ffreedom_cho_s_kit_man.pdf).

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Can CHO-S Cells (cGMP banked) be used for the production of commercial products?

Yes. CHO-S Cells (cGMP banked) are intended (with the purchase of a commercial license) for the development of biologics. They have been produced in a cGMP animal origin-free environment, and have been scaled up in a commercial setting to produce products for clinical testing.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

How successful is the Freedom CHO-S Kit in creating stable clones?

CHO-S clones producing a model IgG protein were assessed for stability by comparing volumetric productivity for over 60 generations. Four out of the five clones that were tested maintained expression levels over 60 generations. Expression levels were considered stable if the titer at the end of the stability assessment (at generation 60) was at least 70% of the titer observed at the beginning of the stability study.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

How long does it take to obtain a lead clone with the Freedom CHO-S Kit?

It is possible to go from transfection to lead clone in as little as 4 months with the Freedom CHO-S Kit.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

What titers can be achieved with the Freedom CHO-S Kit?

Volumetric titers of >1 g/L in simple fed batch, and >3 g/L in fed batch with complex feeds have been obtained with the Freedom CHO-S Kit.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.