Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_101154058_10
          See other ASPH GT Assays ›
          SNP ID:
          rs79877023
          Gene
          ASPH
          Gene Name
          aspartate beta-hydroxylase
          Set Membership:
          -
          Chromosome Location:
          Chr.8: 61668243 - 61668243 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GAAAAAATGAAAATACCTTTAGCCT[C/T]AGTTTTTCTCTTGGCTACCCCACTG

          Assay ID C_101154058_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600582

          Literature Links:

          ASPH PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.00)
          (1.00)
          AMR
          C (0.00)
          (1.00)
          ASPH - aspartate beta-hydroxylase
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001164750.1 429 Intron NP_001158222.1
          NM_001164751.1 429 Intron NP_001158223.1
          NM_001164752.1 429 Intron NP_001158224.1
          NM_001164753.1 429 Intron NP_001158225.1
          NM_001164754.1 429 Intron NP_001158226.1
          NM_001164755.1 429 Intron NP_001158227.1
          NM_001164756.1 429 Intron NP_001158228.1
          NM_004318.3 429 Intron NP_004309.2
          NM_020164.4 429 Missense Mutation AAG,GAG K,E 105 NP_064549.1
          NM_032466.3 429 Intron NP_115855.1
          NM_032467.3 429 Missense Mutation AAG,GAG K,E 90 NP_115856.1
          NM_032468.4 429 Intron NP_115857.1
          XM_005251235.2 429 Intron XP_005251292.1
          XM_005251236.2 429 Intron XP_005251293.1
          XM_005251238.2 429 Intron XP_005251295.1
          XM_005251239.2 429 Intron XP_005251296.1
          XM_005251240.1 429 Intron XP_005251297.1
          XM_005251242.2 429 Intron XP_005251299.1
          XM_005251243.2 429 Intron XP_005251300.1
          XM_005251244.1 429 Intron XP_005251301.1
          XM_005251246.2 429 Intron XP_005251303.1
          XM_005251247.2 429 Intron XP_005251304.1
          XM_005251248.1 429 Intron XP_005251305.1
          XM_005251250.2 429 Intron XP_005251307.1
          XM_017013419.1 429 Intron XP_016868908.1
          XM_017013420.1 429 Intron XP_016868909.1
          XM_017013421.1 429 Intron XP_016868910.1
          XM_017013422.1 429 Intron XP_016868911.1
          XM_017013423.1 429 Intron XP_016868912.1
          XM_017013424.1 429 Intron XP_016868913.1
          XM_017013425.1 429 Intron XP_016868914.1
          XM_017013426.1 429 Intron XP_016868915.1
          XM_017013427.1 429 Intron XP_016868916.1
          XM_017013428.1 429 Intron XP_016868917.1
          XM_017013429.1 429 Intron XP_016868918.1
          XM_017013430.1 429 Intron XP_016868919.1
          XM_017013431.1 429 Intron XP_016868920.1
          XM_017013432.1 429 Intron XP_016868921.1
          XM_017013433.1 429 Intron XP_016868922.1
          XM_017013434.1 429 Intron XP_016868923.1
          XM_017013435.1 429 Intron XP_016868924.1
          XM_017013436.1 429 Intron XP_016868925.1
          XM_017013437.1 429 Intron XP_016868926.1
          XM_017013438.1 429 Intron XP_016868927.1
          XM_017013439.1 429 Intron XP_016868928.1
          XM_017013440.1 429 Intron XP_016868929.1
          XM_017013441.1 429 Intron XP_016868930.1
          XM_017013442.1 429 Intron XP_016868931.1
          XM_017013443.1 429 Intron XP_016868932.1
          XM_017013444.1 429 Intron XP_016868933.1
          XM_017013445.1 429 Intron XP_016868934.1
          XM_017013446.1 429 Intron XP_016868935.1
          XM_017013447.1 429 Intron XP_016868936.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          protein modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          muscle contraction
          pattern specification process
          negative regulation of cell proliferation
          regulation of protein stability
          ion transmembrane transport
          limb morphogenesis
          peptidyl-aspartic acid hydroxylation
          positive regulation of proteolysis
          oxidation-reduction process
          palate development
          face morphogenesis
          activation of cysteine-type endopeptidase activity
          regulation of protein depolymerization
          regulation of cardiac conduction
          peptide-aspartate beta-dioxygenase activity
          structural molecule activity
          calcium ion binding
          protein binding
          structural constituent of muscle
          electron carrier activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline