Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_161160327_10
          See other NAV2 GT Assays ›
          SNP ID:
          rs140706274
          Gene
          NAV2 NAV2-AS2
          Gene Name
          neuron navigator 2
          NAV2 antisense RNA 2
          Set Membership:
          -
          Chromosome Location:
          Chr.11: 20044189 - 20044189 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          ATCTCCCAGACAGGCTCATGGCGGC[A/G]AGGCATGACAGCTCAGGTGGGCATC

          Assay ID C_161160327_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 607026

          Literature Links:

          NAV2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          NAV2 - neuron navigator 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001111018.1 4545 Missense Mutation CAA,CGA Q,R 975 NP_001104488.1
          NM_001111019.2 4545 Missense Mutation CAA,CGA Q,R 125 NP_001104489.1
          NM_001244963.1 4545 Missense Mutation CAA,CGA Q,R 1062 NP_001231892.1
          NM_145117.4 4545 Missense Mutation CAA,CGA Q,R 1039 NP_660093.2
          NM_182964.5 4545 Missense Mutation CAA,CGA Q,R 1039 NP_892009.3
          XM_005253214.4 4545 Missense Mutation CAA,CGA Q,R 125 XP_005253271.1
          XM_006718364.3 4545 Missense Mutation CAA,CGA Q,R 1039 XP_006718427.1
          XM_006718365.3 4545 Missense Mutation CAA,CGA Q,R 1062 XP_006718428.1
          XM_006718366.3 4545 Missense Mutation CAA,CGA Q,R 990 XP_006718429.1
          XM_006718367.3 4545 Missense Mutation CAA,CGA Q,R 125 XP_006718430.1
          XM_006718368.3 4545 Missense Mutation CAA,CGA Q,R 125 XP_006718431.1
          XM_006718369.2 4545 Missense Mutation CAA,CGA Q,R 38 XP_006718432.1
          XM_011520444.2 4545 Missense Mutation CAA,CGA Q,R 1062 XP_011518746.1
          XM_011520445.2 4545 Missense Mutation CAA,CGA Q,R 1062 XP_011518747.1
          XM_011520446.2 4545 Missense Mutation CAA,CGA Q,R 1062 XP_011518748.1
          XM_011520447.2 4545 Missense Mutation CAA,CGA Q,R 1062 XP_011518749.1
          XM_011520448.2 4545 Missense Mutation CAA,CGA Q,R 1019 XP_011518750.1
          XM_011520449.2 4545 Missense Mutation CAA,CGA Q,R 1062 XP_011518751.1
          XM_011520450.2 4545 Missense Mutation CAA,CGA Q,R 1062 XP_011518752.1
          XM_011520451.2 4545 Missense Mutation CAA,CGA Q,R 969 XP_011518753.1
          XM_011520452.2 4545 Missense Mutation CAA,CGA Q,R 975 XP_011518754.1
          XM_011520453.2 4545 Missense Mutation CAA,CGA Q,R 38 XP_011518755.1
          XM_011520454.2 4545 Missense Mutation CAA,CGA Q,R 38 XP_011518756.1
          XM_017018520.1 4545 Missense Mutation CAA,CGA Q,R 998 XP_016874009.1
          XM_017018521.1 4545 Missense Mutation CAA,CGA Q,R 1062 XP_016874010.1
          XM_017018522.1 4545 Missense Mutation CAA,CGA Q,R 975 XP_016874011.1
          XM_017018523.1 4545 Missense Mutation CAA,CGA Q,R 917 XP_016874012.1
          XM_017018524.1 4545 Missense Mutation CAA,CGA Q,R 917 XP_016874013.1
          XM_017018525.1 4545 Missense Mutation CAA,CGA Q,R 717 XP_016874014.1
          XM_017018526.1 4545 Missense Mutation CAA,CGA Q,R 156 XP_016874015.1
          NAV2-AS2 - NAV2 antisense RNA 2
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          regulation of systemic arterial blood pressure by baroreceptor feedback
          sensory perception of sound
          sensory perception of smell
          locomotory behavior
          optic nerve development
          glossopharyngeal nerve development
          vagus nerve development
          helicase activity
          protein binding
          ATP binding
          heparin binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-794c4b9cd6-8pzg4:80/100.66.75.138:80.
          git-commit: 7e8dd63fde7d4486b98ef9ac5cf4e365aa842ffe
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.52.0-Offline