Search
LOADING 
- SNP ID:
- rs142878344
- Gene
-
KLHL17NOC2LSAMD11 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.1: 953249 - 953249 on Build GRCh38
- Polymorphism:
- A/G, Transition Substitution
- Context Sequence [VIC/FAM]:
CTGAGGACCAGGAAAGCCAGCACCC[A/G]CAGAGACTCTTCCCCAGTGCTCCAT
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 610770
MIM: 616765
|
||||||||||||||||||||
Literature Links: |
KLHL17 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| KLHL17 - kelch like family member 17 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| NOC2L - NOC2 like nucleolar associated transcriptional repressor | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_015658.3 | Intron | NP_056473.2 | ||||
| SAMD11 - sterile alpha motif domain containing 11 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To TopMore Information
Additional Information:
For this assay, SNP(s) [rs3748597] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Ontology Categories:
Back To Top