Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_173663170_10
          See other SLC20A2 GT Assays ›
          SNP ID:
          rs113755761
          Gene
          SLC20A2 SMIM19
          Gene Name
          solute carrier family 20 member 2
          small integral membrane protein 19
          Set Membership:
          -
          Chromosome Location:
          Chr.8: 42542090 - 42542090 on Build GRCh38
          Polymorphism:
          T/A, Transversion substitution
          Context Sequence [VIC/FAM]:

          GGAGAGGATTACATTTTCTCCCTGC[T/A]CCACTTGACTTTCTTCCGGAAGGAG

          Assay ID C_173663170_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 158378

          Literature Links:

          SLC20A2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.01)
          (0.99)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.01)
          (0.99)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.03)
          (0.97)
          AMR
          A (0.03)
          (0.97)
          SLC20A2 - solute carrier family 20 member 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001257180.1 469 Intron NP_001244109.1
          NM_001257181.1 469 Intron NP_001244110.1
          NM_006749.4 469 UTR 5 NP_006740.1
          XM_005273613.3 469 Intron XP_005273670.1
          XM_005273615.3 469 Intron XP_005273672.1
          XM_006716390.3 469 Intron XP_006716453.1
          XM_006716391.3 469 Intron XP_006716454.1
          XM_017013748.1 469 UTR 5 XP_016869237.1
          XM_017013749.1 469 Intron XP_016869238.1
          XM_017013750.1 469 Intron XP_016869239.1
          XM_017013751.1 469 Intron XP_016869240.1
          XM_017013752.1 469 UTR 5 XP_016869241.1
          SMIM19 - small integral membrane protein 19
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001135674.1 469 UTR 5 NP_001129146.1
          NM_001135675.1 469 UTR 5 NP_001129147.1
          NM_001135676.1 469 Intron NP_001129148.1
          NM_138436.3 469 Intron NP_612445.2
          XM_005273398.4 469 UTR 5 XP_005273455.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          transport
          ion transport
          phosphate ion transmembrane transport
          sodium ion transmembrane transport
          sodium-dependent phosphate transport
          viral entry into host cell
          virus receptor activity
          receptor activity
          inorganic phosphate transmembrane transporter activity
          sodium:phosphate symporter activity
          sodium:inorganic phosphate symporter activity
          sodium-dependent phosphate transmembrane transporter activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-l7vkb:80/100.66.79.31:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0