Search

  • Order Status
  • Quick Order
  • Promos

System Message

OKCancel
LOADING ...
See other ELAVL2 GT Assays ›
SNP ID:
rs142761114
Gene
ELAVL2
Gene Name
Set Membership:
-
Chromosome Location:
Chr.9: 23692779 - 23692779 on Build GRCh38
Polymorphism:
A/G, Transition substitution
Context Sequence [VIC/FAM]:

TTTGCCACAGGATACTCTCATCTGC[A/G]TCAGGAGCCAGGTTGTACACAAATA

Assay ID C_174796260_10
Size
Availability Made To Order
Catalog # 4351379
Price
Your Price
Online offer:
Check your price ›

Assay Details



Species:

 Human

dbSNP Submissions:

 NA

Phenotype:

 MIM: 601673

Literature Links:

 ELAVL2 PubMed Links

Allele Nomenclature:

Minor Allele Frequency:
1000Genome Applied Biosystems® HapMap
Global
A (0.00)
(1.00)
Caucasian - Not Available CEPH (CEU) - Not Available
EAS
A (0.00)
(1.00)
African American - Not Available YRI (Yoruba) - Not Available
SAS
A (0.00)
(1.00)
Chinese - Not Available CHB (Han Chinese) - Not Available
AFR
A (0.00)
(1.00)
Japanese - Not Available JPT (Japanese) - Not Available
EUR
A (0.00)
(1.00)
AMR
A (0.00)
(1.00)
ELAVL2 - ELAV like neuron-specific RNA binding protein 2
Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
NM_001171195.1 1373 Silent Mutation GAC,GAT D,D 273 NP_001164666.1
NM_001171197.1 1373 Silent Mutation GAC,GAT D,D 273 NP_001164668.1
NM_004432.3 1373 Silent Mutation GAC,GAT D,D 286 NP_004423.2
XM_005251393.3 1373 Silent Mutation GAC,GAT D,D 287 XP_005251450.1
XM_005251394.3 1373 Silent Mutation GAC,GAT D,D 287 XP_005251451.1
XM_005251395.3 1373 Silent Mutation GAC,GAT D,D 287 XP_005251452.1
XM_006716734.3 1373 Silent Mutation GAC,GAT D,D 316 XP_006716797.1
XM_006716735.3 1373 Silent Mutation GAC,GAT D,D 316 XP_006716798.1
XM_006716736.3 1373 Silent Mutation GAC,GAT D,D 287 XP_006716799.1
XM_011517774.2 1373 Silent Mutation GAC,GAT D,D 315 XP_011516076.1
XM_011517776.2 1373 Silent Mutation GAC,GAT D,D 303 XP_011516078.1
XM_011517777.2 1373 Silent Mutation GAC,GAT D,D 302 XP_011516079.1
XM_011517778.2 1373 Silent Mutation GAC,GAT D,D 319 XP_011516080.2
XM_011517779.2 1373 Silent Mutation GAC,GAT D,D 316 XP_011516081.1
XM_011517780.2 1373 Silent Mutation GAC,GAT D,D 316 XP_011516082.1
XM_011517783.2 1373 Silent Mutation GAC,GAT D,D 301 XP_011516085.1
XM_011517784.2 1373 Silent Mutation GAC,GAT D,D 287 XP_011516086.1
XM_011517785.2 1373 Silent Mutation GAC,GAT D,D 287 XP_011516087.1
XM_011517786.2 1373 Silent Mutation GAC,GAT D,D 287 XP_011516088.1
XM_017014408.1 1373 Silent Mutation GAC,GAT D,D 315 XP_016869897.1
XM_017014409.1 1373 Silent Mutation GAC,GAT D,D 315 XP_016869898.1
XM_017014410.1 1373 Silent Mutation GAC,GAT D,D 315 XP_016869899.1
XM_017014411.1 1373 Silent Mutation GAC,GAT D,D 315 XP_016869900.1
XM_017014412.1 1373 Silent Mutation GAC,GAT D,D 315 XP_016869901.1
XM_017014413.1 1373 Silent Mutation GAC,GAT D,D 314 XP_016869902.1
XM_017014414.1 1373 Silent Mutation GAC,GAT D,D 314 XP_016869903.1
XM_017014415.1 1373 Silent Mutation GAC,GAT D,D 303 XP_016869904.1
XM_017014416.1 1373 Silent Mutation GAC,GAT D,D 302 XP_016869905.1
XM_017014417.1 1373 Silent Mutation GAC,GAT D,D 300 XP_016869906.1
XM_017014418.1 1373 Silent Mutation GAC,GAT D,D 287 XP_016869907.1
XM_017014419.1 1373 Silent Mutation GAC,GAT D,D 286 XP_016869908.1
XM_017014420.1 1373 Silent Mutation GAC,GAT D,D 286 XP_016869909.1
XM_017014421.1 1373 Silent Mutation GAC,GAT D,D 286 XP_016869910.1
XM_017014422.1 1373 Silent Mutation GAC,GAT D,D 286 XP_016869911.1
XM_017014423.1 1373 Silent Mutation GAC,GAT D,D 286 XP_016869912.1
XM_017014424.1 1373 Silent Mutation GAC,GAT D,D 273 XP_016869913.1
XM_017014425.1 1373 Silent Mutation GAC,GAT D,D 273 XP_016869914.1
XM_017014426.1 1373 Silent Mutation GAC,GAT D,D 152 XP_016869915.1

Back To Top

Related Products