Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_189792310_10
          See other FADD GT Assays ›
          SNP ID:
          rs201640221
          Gene
          FADD
          Gene Name
          Fas associated via death domain
          Set Membership:
          -
          Chromosome Location:
          Chr.11: 70206267 - 70206267 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          ATACCCCCGCAACCTGACAGAGCGT[A/G]TGCGGGAGTCACTGAGAATCTGGAA

          Assay ID C_189792310_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602457

          Literature Links:

          FADD PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          FADD - Fas associated via death domain
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_003824.3 718 Missense Mutation ATG,GTG M,V 141 NP_003815.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of T cell mediated cytotoxicity
          positive regulation of adaptive immune response
          apoptotic process
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          cell surface receptor signaling pathway
          extrinsic apoptotic signaling pathway via death domain receptors
          positive regulation of interferon-gamma production
          positive regulation of interleukin-8 production
          positive regulation of tumor necrosis factor production
          T cell differentiation in thymus
          TRIF-dependent toll-like receptor signaling pathway
          TRAIL-activated apoptotic signaling pathway
          positive regulation of activated T cell proliferation
          T cell homeostasis
          positive regulation of apoptotic process
          positive regulation of I-kappaB kinase/NF-kappaB signaling
          innate immune response
          positive regulation of macrophage differentiation
          positive regulation of proteolysis
          positive regulation of transcription from RNA polymerase II promoter
          lymph node development
          spleen development
          thymus development
          protein heterooligomerization
          defense response to virus
          positive regulation of type I interferon-mediated signaling pathway
          negative regulation of necroptotic process
          negative regulation of activation-induced cell death of T cells
          cellular response to mechanical stimulus
          death-inducing signaling complex assembly
          motor neuron apoptotic process
          apoptotic signaling pathway
          extrinsic apoptotic signaling pathway
          extrinsic apoptotic signaling pathway in absence of ligand
          activation of cysteine-type endopeptidase activity
          activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway
          necroptotic signaling pathway
          regulation of extrinsic apoptotic signaling pathway via death domain receptors
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          positive regulation of extrinsic apoptotic signaling pathway via death domain receptors
          positive regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation
          positive regulation of extrinsic apoptotic signaling pathway
          protease binding
          death receptor binding
          tumor necrosis factor receptor binding
          protein binding
          protein complex binding
          tumor necrosis factor receptor superfamily binding
          death effector domain binding
          identical protein binding
          caspase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-9fm2r:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline