Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_189952708_10
          See other DDIT3 GT Assays ›
          SNP ID:
          rs201227991
          Gene
          DDIT3 MARS MBD6 MIR616 MIR6758
          Gene Name
          DNA damage inducible transcript 3
          methionyl-tRNA synthetase
          methyl-CpG binding domain protein 6
          microRNA 616
          microRNA 6758
          Set Membership:
          -
          Chromosome Location:
          Chr.12: 57517376 - 57517376 on Build GRCh38
          Polymorphism:
          C/T, Transition Substitution
          Context Sequence [VIC/FAM]:

          TCCAGCTCCCAGCTGGACAGTGTCC[C/T]GAAGGAGAAAGGCAATGACTCAGCT

          Assay ID C_189952708_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 126337 MIM: 156560 MIM: 614489

          Literature Links:

          DDIT3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          DDIT3 - DNA damage inducible transcript 3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001195053.1 368 Missense Mutation AGG,GGG R,G 34 NP_001181982.1
          NM_001195054.1 368 Missense Mutation AGG,GGG R,G 34 NP_001181983.1
          NM_001195055.1 368 Missense Mutation AGG,GGG R,G 34 NP_001181984.1
          NM_001195056.1 368 Missense Mutation AGG,GGG R,G 34 NP_001181985.1
          NM_001195057.1 368 Missense Mutation AGG,GGG R,G 11 NP_001181986.1
          NM_004083.5 368 Missense Mutation AGG,GGG R,G 11 NP_004074.2
          MARS - methionyl-tRNA synthetase
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_004990.3 368 Intron NP_004981.2
          XM_006719398.3 368 Intron XP_006719461.1
          MBD6 - methyl-CpG binding domain protein 6
          There are no transcripts associated with this gene.
          MIR616 - microRNA 616
          There are no transcripts associated with this gene.
          MIR6758 - microRNA 6758
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Additional Information:

          For this assay, SNP(s) [rs697221] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

          Panther Classification:

          Molecular Function -

          aminoacyl-tRNA synthetase ligase

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          blood vessel maturation
          response to amphetamine
          regulation of transcription, DNA-templated
          cellular response to DNA damage stimulus
          ER overload response
          response to unfolded protein
          cell cycle arrest
          aging
          response to nutrient
          Wnt signaling pathway
          positive regulation of interleukin-8 production
          negative regulation of CREB transcription factor activity
          response to endoplasmic reticulum stress
          PERK-mediated unfolded protein response
          ATF6-mediated unfolded protein response
          response to drug
          response to hydrogen peroxide
          response to starvation
          mRNA transcription from RNA polymerase II promoter
          proteasome-mediated ubiquitin-dependent protein catabolic process
          negative regulation of sequence-specific DNA binding transcription factor activity
          positive regulation of neuron apoptotic process
          regulation of DNA-templated transcription in response to stress
          regulation of transcription involved in anterior/posterior axis specification
          cell redox homeostasis
          negative regulation of fat cell differentiation
          negative regulation of myoblast differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          embryonic organ development
          release of sequestered calcium ion into cytosol
          negative regulation of protein kinase B signaling
          intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress
          negative regulation of canonical Wnt signaling pathway
          positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway
          negative regulation of RNA polymerase II regulatory region sequence-specific DNA binding
          positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress
          negative regulation of determination of dorsal identity
          tRNA aminoacylation for protein translation
          methionyl-tRNA aminoacylation
          transcription regulatory region sequence-specific DNA binding
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          DNA binding
          transcription factor activity, sequence-specific DNA binding
          transcription corepressor activity
          protein binding
          transcription factor binding
          cAMP response element binding protein binding
          protein homodimerization activity
          leucine zipper domain binding
          transcription regulatory region DNA binding
          protein heterodimerization activity
          tRNA binding
          methionine-tRNA ligase activity
          ATP binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-6479c7f679-zb4k5:80/100.66.74.142:80.
          git-commit: b70c0dceb888abc3b0dcebb5bc3a5b8753e7e816
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.50.0-Offline