Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_190521953_10
          See other DMKN GT Assays ›
          SNP ID:
          rs201569702
          Gene
          DMKN KRTDAP
          Gene Name
          dermokine
          keratinocyte differentiation associated protein
          Set Membership:
          -
          Chromosome Location:
          Chr.19: 35498719 - 35498719 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GTCGGCTCACTCTGACACTCACCTA[C/T]CAAAACTTCACCCACTGCAGCAGGC

          Assay ID C_190521953_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          Literature Links:

          DMKN PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          DMKN - dermokine
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001035516.3 727 Nonsense Mutation TGA,TGG *,W 90 NP_001030593.1
          NM_001126056.2 727 Nonsense Mutation TGA,TGG *,W 465 NP_001119528.2
          NM_001126057.2 727 Intron NP_001119529.2
          NM_001126058.2 727 Intron NP_001119530.2
          NM_001126059.2 727 Nonsense Mutation TGA,TGG *,W 189 NP_001119531.1
          NM_001190347.1 727 Nonsense Mutation TGA,TGG *,W 449 NP_001177276.1
          NM_001190348.1 727 Intron NP_001177277.1
          NM_001190349.1 727 Intron NP_001177278.1
          NM_001308380.1 727 Nonsense Mutation TGA,TGG *,W 203 NP_001295309.1
          NM_001308383.1 727 Nonsense Mutation TGA,TGG *,W 172 NP_001295312.1
          NM_033317.4 727 Nonsense Mutation TGA,TGG *,W 476 NP_201574.3
          XM_006723477.1 727 Nonsense Mutation TGA,TGG *,W 253 XP_006723540.1
          XM_006723484.1 727 Nonsense Mutation TGA,TGG *,W 223 XP_006723547.1
          XM_006723489.1 727 Nonsense Mutation TGA,TGG *,W 184 XP_006723552.1
          XM_006723493.2 727 Nonsense Mutation TGA,TGG *,W 152 XP_006723556.1
          XM_006723494.2 727 Nonsense Mutation TGA,TGG *,W 146 XP_006723557.1
          XM_006723503.2 727 Nonsense Mutation TGA,TGG *,W 184 XP_006723566.1
          XM_011527494.2 727 Nonsense Mutation TGA,TGG *,W 538 XP_011525796.1
          XM_011527495.2 727 Nonsense Mutation TGA,TGG *,W 538 XP_011525797.1
          XM_011527496.2 727 Nonsense Mutation TGA,TGG *,W 526 XP_011525798.1
          XM_011527497.2 727 Nonsense Mutation TGA,TGG *,W 524 XP_011525799.1
          XM_011527498.2 727 Nonsense Mutation TGA,TGG *,W 524 XP_011525800.1
          XM_011527499.2 727 Nonsense Mutation TGA,TGG *,W 523 XP_011525801.1
          XM_011527500.2 727 Nonsense Mutation TGA,TGG *,W 520 XP_011525802.1
          XM_011527501.2 727 Nonsense Mutation TGA,TGG *,W 518 XP_011525803.1
          XM_011527502.2 727 Nonsense Mutation TGA,TGG *,W 508 XP_011525804.1
          XM_011527503.2 727 Nonsense Mutation TGA,TGG *,W 506 XP_011525805.1
          XM_011527504.2 727 Nonsense Mutation TGA,TGG *,W 500 XP_011525806.1
          XM_011527505.2 727 Nonsense Mutation TGA,TGG *,W 491 XP_011525807.1
          XM_011527506.2 727 Nonsense Mutation TGA,TGG *,W 488 XP_011525808.1
          XM_011527507.2 727 Nonsense Mutation TGA,TGG *,W 476 XP_011525809.1
          XM_011527508.2 727 Nonsense Mutation TGA,TGG *,W 471 XP_011525810.1
          XM_011527509.2 727 Nonsense Mutation TGA,TGG *,W 457 XP_011525811.1
          XM_011527510.2 727 Nonsense Mutation TGA,TGG *,W 456 XP_011525812.1
          XM_011527511.2 727 Intron XP_011525813.1
          XM_011527512.2 727 Intron XP_011525814.1
          XM_011527513.1 727 Nonsense Mutation TGA,TGG *,W 206 XP_011525815.1
          XM_011527514.1 727 Nonsense Mutation TGA,TGG *,W 186 XP_011525816.1
          XM_017027475.1 727 Nonsense Mutation TGA,TGG *,W 221 XP_016882964.1
          XM_017027476.1 727 Nonsense Mutation TGA,TGG *,W 184 XP_016882965.1
          XM_017027477.1 727 Nonsense Mutation TGA,TGG *,W 137 XP_016882966.1
          KRTDAP - keratinocyte differentiation associated protein
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          cornified envelope assembly
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-2lcrw:80/100.66.78.62:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0