Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_191895459_10
          See other CUL1 GT Assays ›
          SNP ID:
          rs193921147
          Gene
          CUL1 EZH2
          Gene Name
          cullin 1
          enhancer of zeste 2 polycomb repressive complex 2 subunit
          Set Membership:
          -
          Chromosome Location:
          Chr.7: 148809340 - 148809340 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          GCATAGCAGTTTGGATTTACCGAAT[G/A]ATTTGCAAAACGAATTTTGTTACCC

          Assay ID C_191895459_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603134 MIM: 601573

          Literature Links:

          CUL1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CUL1 - cullin 1
          There are no transcripts associated with this gene.
          EZH2 - enhancer of zeste 2 polycomb repressive complex 2 subunit
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001203247.1 4599 Missense Mutation CAT,TAT H,Y 689 NP_001190176.1
          NM_001203248.1 4599 Missense Mutation CAT,TAT H,Y 680 NP_001190177.1
          NM_001203249.1 4599 Missense Mutation CAT,TAT H,Y 638 NP_001190178.1
          NM_004456.4 4599 Missense Mutation CAT,TAT H,Y 694 NP_004447.2
          NM_152998.2 4599 Missense Mutation CAT,TAT H,Y 650 NP_694543.1
          XM_005249962.4 4599 Missense Mutation CAT,TAT H,Y 697 XP_005250019.1
          XM_005249963.4 4599 Missense Mutation CAT,TAT H,Y 688 XP_005250020.1
          XM_005249964.4 4599 Missense Mutation CAT,TAT H,Y 646 XP_005250021.1
          XM_011515883.2 4599 Missense Mutation CAT,TAT H,Y 702 XP_011514185.1
          XM_011515884.2 4599 Missense Mutation CAT,TAT H,Y 694 XP_011514186.1
          XM_011515885.2 4599 Missense Mutation CAT,TAT H,Y 693 XP_011514187.1
          XM_011515886.2 4599 Missense Mutation CAT,TAT H,Y 686 XP_011514188.1
          XM_011515887.2 4599 Missense Mutation CAT,TAT H,Y 685 XP_011514189.1
          XM_011515888.2 4599 Missense Mutation CAT,TAT H,Y 685 XP_011514190.1
          XM_011515889.2 4599 Missense Mutation CAT,TAT H,Y 672 XP_011514191.1
          XM_011515890.2 4599 Missense Mutation CAT,TAT H,Y 663 XP_011514192.1
          XM_011515891.2 4599 Missense Mutation CAT,TAT H,Y 661 XP_011514193.1
          XM_011515892.2 4599 Missense Mutation CAT,TAT H,Y 660 XP_011514194.1
          XM_011515893.2 4599 Missense Mutation CAT,TAT H,Y 658 XP_011514195.1
          XM_011515894.2 4599 Missense Mutation CAT,TAT H,Y 655 XP_011514196.1
          XM_011515895.2 4599 Missense Mutation CAT,TAT H,Y 654 XP_011514197.1
          XM_011515896.2 4599 Missense Mutation CAT,TAT H,Y 616 XP_011514198.1
          XM_011515897.2 4599 Missense Mutation CAT,TAT H,Y 585 XP_011514199.1
          XM_011515898.2 4599 Missense Mutation CAT,TAT H,Y 585 XP_011514200.1
          XM_011515899.2 4599 Intron XP_011514201.1
          XM_011515901.2 4599 Intron XP_011514203.1
          XM_017011817.1 4599 Missense Mutation CAT,TAT H,Y 702 XP_016867306.1
          XM_017011818.1 4599 Missense Mutation CAT,TAT H,Y 681 XP_016867307.1
          XM_017011819.1 4599 Missense Mutation CAT,TAT H,Y 655 XP_016867308.1
          XM_017011820.1 4599 Missense Mutation CAT,TAT H,Y 646 XP_016867309.1
          XM_017011821.1 4599 Missense Mutation CAT,TAT H,Y 580 XP_016867310.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          histone modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          DNA methylation
          chromatin organization
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          positive regulation of epithelial to mesenchymal transition
          regulation of gliogenesis
          skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration
          cerebellar cortex development
          hippocampus development
          response to estradiol
          negative regulation of transcription elongation from RNA polymerase II promoter
          regulation of cell proliferation
          regulation of circadian rhythm
          positive regulation of MAP kinase activity
          negative regulation of sequence-specific DNA binding transcription factor activity
          positive regulation of GTPase activity
          negative regulation of epidermal cell differentiation
          negative regulation of gene expression, epigenetic
          negative regulation of transcription, DNA-templated
          negative regulation of retinoic acid receptor signaling pathway
          rhythmic process
          negative regulation of striated muscle cell differentiation
          cellular response to hydrogen peroxide
          G1 to G0 transition
          histone H3-K27 methylation
          protein localization to chromatin
          positive regulation of protein serine/threonine kinase activity
          positive regulation of dendrite development
          negative regulation of G1/S transition of mitotic cell cycle
          core promoter binding
          DNA binding
          chromatin binding
          RNA binding
          protein binding
          protein-lysine N-methyltransferase activity
          histone-lysine N-methyltransferase activity
          chromatin DNA binding
          histone methyltransferase activity
          ribonucleoprotein complex binding
          sequence-specific DNA binding
          histone methyltransferase activity (H3-K27 specific)
          promoter-specific chromatin binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-dd86746ff-lmgjf:80/100.66.77.199:80.
          git-commit: 04e44c58f20fafe66519586ffe6db5d8a90e52ce
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.53.1-Offline