Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_191916288_10
          See other MTSS1 GT Assays ›
          SNP ID:
          rs201125981
          Gene
          MTSS1 NDUFB9
          Gene Name
          metastasis suppressor 1
          NADH:ubiquinone oxidoreductase subunit B9
          Set Membership:
          -
          Chromosome Location:
          Chr.8: 124553267 - 124553267 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          GGGTTAACGGAAGCTTGGCCGCTCC[A/C]CATTGAGGAGGGCATGCTGGTGACA

          Assay ID C_191916288_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 608486 MIM: 601445

          Literature Links:

          MTSS1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.00)
          (1.00)
          AMR
          C (0.00)
          (1.00)
          MTSS1 - metastasis suppressor 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001282971.1 2095 Missense Mutation GGG,TGG G,W 669 NP_001269900.1
          NM_001282974.1 2095 Missense Mutation GGG,TGG G,W 640 NP_001269903.1
          NM_014751.5 2095 Missense Mutation GGG,TGG G,W 665 NP_055566.3
          XM_005251111.1 2095 Missense Mutation GGG,TGG G,W 778 XP_005251168.1
          XM_005251113.1 2095 Missense Mutation GGG,TGG G,W 713 XP_005251170.1
          XM_005251118.1 2095 Missense Mutation GGG,TGG G,W 604 XP_005251175.1
          XM_006716700.1 2095 Missense Mutation GGG,TGG G,W 777 XP_006716763.1
          XM_006716701.1 2095 Missense Mutation GGG,TGG G,W 774 XP_006716764.1
          XM_006716702.1 2095 Missense Mutation GGG,TGG G,W 761 XP_006716765.1
          XM_006716703.1 2095 Missense Mutation GGG,TGG G,W 696 XP_006716766.1
          XM_006716704.1 2095 Missense Mutation GGG,TGG G,W 668 XP_006716767.1
          XM_006716705.1 2095 Missense Mutation GGG,TGG G,W 652 XP_006716768.1
          XM_006716706.1 2095 Missense Mutation GGG,TGG G,W 587 XP_006716769.1
          XM_011517403.1 2095 Missense Mutation GGG,TGG G,W 711 XP_011515705.1
          XM_011517404.2 2095 Missense Mutation GGG,TGG G,W 697 XP_011515706.1
          XM_011517407.1 2095 Missense Mutation GGG,TGG G,W 420 XP_011515709.1
          XM_017014086.1 2095 Missense Mutation GGG,TGG G,W 773 XP_016869575.1
          XM_017014087.1 2095 Missense Mutation GGG,TGG G,W 753 XP_016869576.1
          XM_017014088.1 2095 Missense Mutation GGG,TGG G,W 749 XP_016869577.1
          XM_017014089.1 2095 Missense Mutation GGG,TGG G,W 748 XP_016869578.1
          XM_017014090.1 2095 Missense Mutation GGG,TGG G,W 723 XP_016869579.1
          XM_017014091.1 2095 Missense Mutation GGG,TGG G,W 715 XP_016869580.1
          XM_017014092.1 2095 Missense Mutation GGG,TGG G,W 709 XP_016869581.1
          XM_017014093.1 2095 Missense Mutation GGG,TGG G,W 664 XP_016869582.1
          XM_017014094.1 2095 Missense Mutation GGG,TGG G,W 648 XP_016869583.1
          XM_017014095.1 2095 Missense Mutation GGG,TGG G,W 644 XP_016869584.1
          XM_017014096.1 2095 Missense Mutation GGG,TGG G,W 643 XP_016869585.1
          XM_017014097.1 2095 Missense Mutation GGG,TGG G,W 639 XP_016869586.1
          XM_017014098.1 2095 Missense Mutation GGG,TGG G,W 600 XP_016869587.1
          XM_017014099.1 2095 Missense Mutation GGG,TGG G,W 599 XP_016869588.1
          XM_017014100.1 2095 Missense Mutation GGG,TGG G,W 583 XP_016869589.1
          XM_017014101.1 2095 Missense Mutation GGG,TGG G,W 559 XP_016869590.1
          NDUFB9 - NADH:ubiquinone oxidoreductase subunit B9
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          actin or actin-binding cytoskeletal protein

          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of defense response to virus by host
          movement of cell or subcellular component
          plasma membrane organization
          cell adhesion
          transmembrane receptor protein tyrosine kinase signaling pathway
          microspike assembly
          actin cytoskeleton organization
          negative regulation of epithelial cell proliferation
          renal tubule morphogenesis
          cellular response to fluid shear stress
          glomerulus morphogenesis
          nephron tubule epithelial cell differentiation
          xenophagy
          epithelial cell proliferation involved in renal tubule morphogenesis
          actin monomer binding
          receptor binding
          protein binding
          identical protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-794c4b9cd6-nnt95:80/100.66.79.76:80.
          git-commit: 7e8dd63fde7d4486b98ef9ac5cf4e365aa842ffe
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.52.0-Offline