Search
Search

ADCY6
LINC00935
MIR4701CCATTGCCCGACATTCACAAGGGGT[A/G]GGTGTGGTGGCCAAGGCTTGGAAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
ADCY6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| ADCY6 - adenylate cyclase 6 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_015270.4 | Intron | NP_056085.1 | ||||
| XM_006719210.3 | Intron | XP_006719273.1 | ||||
| XM_017018743.1 | Intron | XP_016874232.1 | ||||
| LINC00935 - long intergenic non-protein coding RNA 935 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| MIR4701 - microRNA 4701 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||