Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_335977213_10
          See other GREM1 GT Assays ›
          SNP ID:
          rs780312262
          Gene
          GREM1
          Gene Name
          gremlin 1, DAN family BMP antagonist
          Set Membership:
          -
          Chromosome Location:
          Chr.15: 32729922 - 32729922 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GTGAGAGGTGAAGCCTCATGAGTCA[C/T]GTCACCTACACGCTACTGTCTTTCA

          Assay ID C_335977213_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603054

          Literature Links:

          GREM1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          GREM1 - gremlin 1, DAN family BMP antagonist
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001191322.1 Intron NP_001178251.1
          NM_001191323.1 Intron NP_001178252.1
          NM_013372.6 Intron NP_037504.1
          XM_005254301.2 Intron XP_005254358.1
          XM_017022077.1 Intron XP_016877566.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          cell morphogenesis
          branching involved in ureteric bud morphogenesis
          cell migration involved in sprouting angiogenesis
          positive regulation of receptor internalization
          positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation
          mesenchymal to epithelial transition involved in metanephros morphogenesis
          apoptotic process
          signal transduction
          activation of transmembrane receptor protein tyrosine kinase activity
          cell-cell signaling
          positive regulation of cell proliferation
          proximal/distal pattern formation
          regulation of epithelial to mesenchymal transition
          collagen fibril organization
          negative regulation of cell growth
          embryonic limb morphogenesis
          negative regulation of bone mineralization
          negative regulation of BMP signaling pathway
          negative regulation of chondrocyte differentiation
          regulation of stress-activated MAPK cascade
          negative regulation of osteoblast proliferation
          positive regulation of NF-kappaB import into nucleus
          negative regulation of apoptotic process
          positive regulation of angiogenesis
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          negative regulation of bone remodeling
          determination of dorsal identity
          positive regulation of NF-kappaB transcription factor activity
          regulation of focal adhesion assembly
          positive regulation of telomerase activity
          limb development
          negative regulation of pathway-restricted SMAD protein phosphorylation
          ureteric bud formation
          positive regulation of protein tyrosine kinase activity
          signal transduction by p53 class mediator
          negative regulation of monocyte chemotaxis
          negative regulation of canonical Wnt signaling pathway
          positive regulation of branching involved in ureteric bud morphogenesis
          negative regulation of branching involved in ureteric bud morphogenesis
          negative regulation of osteoclast proliferation
          positive regulation of peptidyl-tyrosine autophosphorylation
          negative regulation of bone trabecula formation
          negative regulation of bone mineralization involved in bone maturation
          positive regulation of receptor activity
          positive regulation of cardiac muscle cell differentiation
          cytokine activity
          protein binding
          morphogen activity
          transmembrane receptor protein tyrosine kinase activator activity
          BMP binding
          vascular endothelial growth factor receptor 2 binding
          receptor agonist activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline