Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_364619656_10
          See other PTAFR GT Assays ›
          SNP ID:
          rs780176624
          Gene
          PTAFR
          Gene Name
          platelet activating factor receptor
          Set Membership:
          -
          Chromosome Location:
          Chr.1: 28150056 - 28150056 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GCACAACCACTTCAGTGACCGTATC[C/T]GTGGTGGCCCGGGAGCATTTCCGGC

          Assay ID C_364619656_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          4 submissions

          Phenotype:

          MIM: 173393

          Literature Links:

          PTAFR PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          PTAFR - platelet activating factor receptor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000952.4 1301 Silent Mutation ACA,ACG T,T 322 NP_000943.1
          NM_001164721.1 1301 Silent Mutation ACA,ACG T,T 322 NP_001158193.1
          NM_001164722.2 1301 Silent Mutation ACA,ACG T,T 322 NP_001158194.1
          NM_001164723.2 1301 Silent Mutation ACA,ACG T,T 322 NP_001158195.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          cytokine production
          regulation of transcription from RNA polymerase II promoter
          chemotaxis
          inflammatory response
          immune response
          G-protein coupled receptor signaling pathway
          parturition
          response to symbiotic bacterium
          positive regulation of phospholipase C activity
          lipopolysaccharide-mediated signaling pathway
          positive regulation of tumor necrosis factor production
          inositol trisphosphate biosynthetic process
          G-protein coupled purinergic nucleotide receptor signaling pathway
          positive regulation of neutrophil degranulation
          transcytosis
          positive regulation of interleukin-6 biosynthetic process
          positive regulation of translation
          negative regulation of blood pressure
          positive regulation of vasoconstriction
          positive regulation of vasodilation
          phosphatidylinositol-mediated signaling
          positive regulation of smooth muscle cell proliferation
          interferon-gamma-mediated signaling pathway
          positive regulation of inositol phosphate biosynthetic process
          cellular response to gravity
          cellular response to cAMP
          cellular response to fatty acid
          response to dexamethasone
          positive regulation of voltage-gated chloride channel activity
          positive regulation of leukocyte tethering or rolling
          positive regulation of sensory perception of pain
          positive regulation of transcytosis
          positive regulation of maternal process involved in parturition
          positive regulation of gastro-intestinal system smooth muscle contraction
          cellular response to 2-O-acetyl-1-O-hexadecyl-sn-glycero-3-phosphocholine
          lipopolysaccharide binding
          lipopolysaccharide receptor activity
          G-protein coupled receptor activity
          platelet activating factor receptor activity
          phospholipid binding
          G-protein coupled purinergic nucleotide receptor activity
          mitogen-activated protein kinase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline