Search
LOADING 
- SNP ID:
- rs753366203
- Gene
-
AMIGO3GMPPBIP6K1RNF123 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.3: 49722129 - 49722129 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
TTGGGGCCAATGCTGCAGTTCTGGC[C/T]GATGCGGGCACTTGGGTCCTGAGAG
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615691
MIM: 615320
MIM: 606991
MIM: 614472
|
||||||||||||||||||||
Literature Links: |
AMIGO3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| AMIGO3 - adhesion molecule with Ig like domain 3 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| GMPPB - GDP-mannose pyrophosphorylase B | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_013334.3 | 1035 | Missense Mutation | AGC,GGC | S,G 263 | NP_037466.2 | |
| NM_021971.2 | 1035 | Missense Mutation | AGC,GGC | S,G 263 | NP_068806.1 | |
| IP6K1 - inositol hexakisphosphate kinase 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| RNF123 - ring finger protein 123 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_022064.4 | 1035 | Intron | NP_071347.2 | |||
| XM_006713285.1 | 1035 | Intron | XP_006713348.1 | |||
| XM_011533995.1 | 1035 | Intron | XP_011532297.1 | |||
| XM_017007018.1 | 1035 | Intron | XP_016862507.1 | |||
Back To Top