Search
Search

AK6
RAD17
TAF9TTGTCAAACTGTAAAATCATGACAT[T/C]ATGTTTAACTGCCATCCTAGAACTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
AK6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| AK6 - adenylate kinase 6 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001015891.1 | Intron | NP_001015891.1 | ||||
| NM_016283.4 | Intron | NP_057367.1 | ||||
| RAD17 - RAD17 checkpoint clamp loader component | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| TAF9 - TATA-box binding protein associated factor 9 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||