Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_397308085_10
          See other HYMAI GT Assays ›
          SNP ID:
          rs746355836
          Gene
          HYMAI PLAGL1
          Gene Name
          hydatidiform mole associated and imprinted (non-protein coding)
          PLAG1 like zinc finger 1
          Set Membership:
          -
          Chromosome Location:
          Chr.6: 144005291 - 144005291 on Build GRCh38
          Polymorphism:
          T/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          AAAAAATATCACAATGAAAAAATCT[T/G]AAATTCTTAGAACTGAACAATATAC

          Assay ID C_397308085_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 606546 MIM: 603044

          Literature Links:

          HYMAI PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          HYMAI - hydatidiform mole associated and imprinted (non-protein coding)
          There are no transcripts associated with this gene.
          PLAGL1 - PLAG1 like zinc finger 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001080951.2 Intron NP_001074420.1
          NM_001080952.2 Intron NP_001074421.1
          NM_001080953.2 Intron NP_001074422.1
          NM_001080954.2 Intron NP_001074423.1
          NM_001080955.2 Intron NP_001074424.1
          NM_001080956.2 Intron NP_001074425.1
          NM_001289037.1 Intron NP_001275966.1
          NM_001289038.1 Intron NP_001275967.1
          NM_001289039.1 Intron NP_001275968.1
          NM_001289040.1 Intron NP_001275969.1
          NM_001289041.1 Intron NP_001275970.1
          NM_001289042.1 Intron NP_001275971.1
          NM_001289043.1 Intron NP_001275972.1
          NM_001289044.1 Intron NP_001275973.1
          NM_001289045.1 Intron NP_001275974.1
          NM_001289046.1 Intron NP_001275975.1
          NM_001289047.1 Intron NP_001275976.1
          NM_001289048.1 Intron NP_001275977.1
          NM_001289049.1 Intron NP_001275978.1
          NM_001317156.1 Intron NP_001304085.1
          NM_001317157.1 Intron NP_001304086.1
          NM_001317158.1 Intron NP_001304087.1
          NM_001317159.1 Intron NP_001304088.1
          NM_001317160.1 Intron NP_001304089.1
          NM_001317161.1 Intron NP_001304090.1
          NM_001317162.1 Intron NP_001304091.1
          NM_006718.4 Intron NP_006709.2

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          C2H2 zinc finger transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          transcription from RNA polymerase II promoter
          apoptotic process
          DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest
          cell cycle arrest
          cell differentiation
          skeletal muscle cell differentiation
          positive regulation of transcription from RNA polymerase II promoter
          RNA polymerase II regulatory region sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding
          DNA binding
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-lffdw:80/100.66.79.31:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0