Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__11742072_10
          See other UGT1A8 GT Assays ›
          SNP ID:
          rs1042597
          Gene
          UGT1A8
          Gene Name
          UDP glucuronosyltransferase family 1 member A8
          Set Membership:
          > DME > Validated > Inventoried
          Chromosome Location:
          Chr.2: 233618225 - 233618225 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          TCTGTGGTCTTCGCCAGGGGAATAG[C/G]TTGCCACTATCTTGAAGAAGGTGCA

          Assay ID C__11742072_10
          Size VIC-FAM | 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 606433

          Literature Links:

          UGT1A8 PubMed Links

          Allele Nomenclature:

          UGT1A8*2,c.518C>G UGT1A8*2,c.518G>C UGT1A8*2,g.518G>C

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.26)
          (0.74)
          Caucasian
          G (0.24)
          (0.76)
          CEPH (CEU) - Not Available
          EAS
          C (0.49)
          (0.51)
          African American
          G (0.08)
          (0.92)
          YRI (Yoruba) - Not Available
          SAS
          G (0.28)
          (0.72)
          Japanese
          C (0.47)
          (0.53)
          CHB (Han Chinese) - Not Available
          AFR
          G (0.03)
          (0.97)
          Chinese
          C (0.41)
          (0.59)
          JPT (Japanese) - Not Available
          EUR
          G (0.25)
          (0.75)
          AMR
          G (0.30)
          (0.70)
          UGT1A8 - UDP glucuronosyltransferase family 1 member A8
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_019076.4 581 Missense Mutation GCT,GGT A,G 173 NP_061949.3

          Back To Top

          More Information


          Set Membership:

          DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          glycosyltransferase

          Gene Ontology Categories:

          Function(s) Process(es)

          fatty acid metabolic process
          steroid metabolic process
          coumarin metabolic process
          retinoic acid metabolic process
          negative regulation of catalytic activity
          negative regulation of fatty acid metabolic process
          negative regulation of steroid metabolic process
          flavone metabolic process
          flavonoid glucuronidation
          xenobiotic glucuronidation
          retinoic acid binding
          enzyme inhibitor activity
          steroid binding
          fatty acid binding
          glucuronosyltransferase activity
          protein homodimerization activity
          protein heterodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-794c4b9cd6-2x6nv:80/100.66.78.26:80.
          git-commit: 7e8dd63fde7d4486b98ef9ac5cf4e365aa842ffe
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.52.0-Offline