Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__15877554_40
          See other SLC22A1 GT Assays ›
          SNP ID:
          rs2282143
          Gene
          SLC22A1
          Gene Name
          solute carrier family 22 member 1
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.6: 160136611 - 160136611 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TCATTTGCAGACCTGTTCCGCACGC[C/T]GCGCCTGAGGAAGCGCACCTTCATC

          Assay ID C__15877554_40
          Size VIC-FAM | 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602607

          Literature Links:

          SLC22A1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.07)
          (0.93)
          Caucasian
          T (0.00)
          (1.00)
          CEPH (CEU) - Not Available
          EAS
          T (0.13)
          (0.87)
          African American
          T (0.10)
          (0.90)
          YRI (Yoruba)
          T (0.08)
          (0.92)
          SAS
          T (0.08)
          (0.92)
          Japanese
          T (0.12)
          (0.88)
          JPT (Japanese)
          T (0.13)
          (0.87)
          AFR
          T (0.08)
          (0.92)
          Chinese
          T (0.16)
          (0.84)
          CHB (Han Chinese)
          T (0.19)
          (0.81)
          EUR
          T (0.01)
          (0.99)
          AMR
          T (0.02)
          (0.98)
          SLC22A1 - solute carrier family 22 member 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_003057.2 1169 Missense Mutation CCG,CTG P,L 341 NP_003048.1
          NM_153187.1 1169 Missense Mutation CCG,CTG P,L 341 NP_694857.1
          XM_005267102.4 1169 Missense Mutation CCG,CTG P,L 341 XP_005267159.1
          XM_005267103.1 1169 Missense Mutation CCG,CTG P,L 341 XP_005267160.1
          XM_005267104.4 1169 Missense Mutation CCG,CTG P,L 149 XP_005267161.1
          XM_005267105.4 1169 Missense Mutation CCG,CTG P,L 149 XP_005267162.1
          XM_006715552.1 1169 Missense Mutation CCG,CTG P,L 341 XP_006715615.1
          XM_011536074.2 1169 Missense Mutation CCG,CTG P,L 149 XP_011534376.1

          Back To Top

          More Information


          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          secondary carrier transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          neurotransmitter transport
          drug transmembrane transport
          establishment or maintenance of transmembrane electrochemical gradient
          organic cation transport
          quaternary ammonium group transport
          dopamine transport
          norepinephrine transport
          epinephrine transport
          protein homooligomerization
          ammonium transmembrane transport
          acetate ester transport
          acetylcholine transmembrane transporter activity
          dopamine transmembrane transporter activity
          norepinephrine transmembrane transporter activity
          protein binding
          secondary active organic cation transmembrane transporter activity
          organic cation transmembrane transporter activity
          quaternary ammonium group transmembrane transporter activity
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-7c59b9b899-7wltc:80/100.66.72.81:80.
          git-commit: 8ef7cf686e3c81d28b13492708ce56d167b2f995
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.49.0-Offline