Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__15877554_40
          See other SLC22A1 GT Assays ›
          SNP ID:
          rs2282143
          Gene
          SLC22A1
          Gene Name
          solute carrier family 22 member 1
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.6: 160136611 - 160136611 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TCATTTGCAGACCTGTTCCGCACGC[C/T]GCGCCTGAGGAAGCGCACCTTCATC

          Assay ID C__15877554_40
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602607

          Literature Links:

          SLC22A1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.07)
          (0.93)
          Caucasian
          T (0.00)
          (1.00)
          CEPH (CEU) - Not Available
          EAS
          T (0.13)
          (0.87)
          African American
          T (0.10)
          (0.90)
          YRI (Yoruba)
          T (0.08)
          (0.92)
          SAS
          T (0.08)
          (0.92)
          Japanese
          T (0.12)
          (0.88)
          JPT (Japanese)
          T (0.13)
          (0.87)
          AFR
          T (0.08)
          (0.92)
          Chinese
          T (0.16)
          (0.84)
          CHB (Han Chinese)
          T (0.19)
          (0.81)
          EUR
          T (0.01)
          (0.99)
          AMR
          T (0.02)
          (0.98)
          SLC22A1 - solute carrier family 22 member 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_003057.2 1169 Missense Mutation CCG,CTG P,L 341 NP_003048.1
          NM_153187.1 1169 Missense Mutation CCG,CTG P,L 341 NP_694857.1
          XM_005267102.4 1169 Missense Mutation CCG,CTG P,L 341 XP_005267159.1
          XM_005267103.1 1169 Missense Mutation CCG,CTG P,L 341 XP_005267160.1
          XM_005267104.4 1169 Missense Mutation CCG,CTG P,L 149 XP_005267161.1
          XM_005267105.4 1169 Missense Mutation CCG,CTG P,L 149 XP_005267162.1
          XM_006715552.1 1169 Missense Mutation CCG,CTG P,L 341 XP_006715615.1
          XM_011536074.2 1169 Missense Mutation CCG,CTG P,L 149 XP_011534376.1

          Back To Top

          More Information


          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          secondary carrier transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          neurotransmitter transport
          drug transmembrane transport
          establishment or maintenance of transmembrane electrochemical gradient
          organic cation transport
          quaternary ammonium group transport
          dopamine transport
          norepinephrine transport
          epinephrine transport
          protein homooligomerization
          ammonium transmembrane transport
          acetate ester transport
          acetylcholine transmembrane transporter activity
          dopamine transmembrane transporter activity
          norepinephrine transmembrane transporter activity
          protein binding
          secondary active organic cation transmembrane transporter activity
          organic cation transmembrane transporter activity
          quaternary ammonium group transmembrane transporter activity
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-zdkzh:80/100.66.76.145:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline