Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__15903863_10
          See other NOS3 GT Assays ›
          SNP ID:
          rs2070744
          Gene
          NOS3
          Gene Name
          nitric oxide synthase 3
          Set Membership:
          -
          Chromosome Location:
          Chr.7: 150992991 - 150992991 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          CCAGGGCATCAAGCTCTTCCCTGGC[C/T]GGCTGACCCTGCCTCAGCCCTAGTC

          Assay ID C__15903863_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 163729

          Literature Links:

          NOS3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.23)
          (0.77)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.12)
          (0.88)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.26)
          (0.74)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.14)
          (0.86)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.44)
          (0.56)
          AMR
          C (0.26)
          (0.74)
          NOS3 - nitric oxide synthase 3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000603.4 Intron NP_000594.2
          NM_001160109.1 Intron NP_001153581.1
          NM_001160110.1 Intron NP_001153582.1
          NM_001160111.1 Intron NP_001153583.1
          XM_006716002.3 Intron XP_006716065.1
          XM_017012232.1 Intron XP_016867721.1
          XM_017012233.1 Intron XP_016867722.1
          XM_017012234.1 Intron XP_016867723.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          oxidoreductase protein modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          angiogenesis
          ovulation from ovarian follicle
          in utero embryonic development
          blood vessel remodeling
          regulation of sodium ion transport
          regulation of the force of heart contraction by chemical signal
          regulation of systemic arterial blood pressure by endothelin
          arginine catabolic process
          nitric oxide biosynthetic process
          mitochondrion organization
          nitric oxide mediated signal transduction
          regulation of blood pressure
          negative regulation of cell proliferation
          response to heat
          negative regulation of platelet activation
          negative regulation of muscle hyperplasia
          smooth muscle hyperplasia
          removal of superoxide radicals
          lung development
          positive regulation of guanylate cyclase activity
          lipopolysaccharide-mediated signaling pathway
          response to fluid shear stress
          negative regulation of potassium ion transport
          endothelial cell migration
          cell redox homeostasis
          positive regulation of angiogenesis
          negative regulation of blood pressure
          positive regulation of vasodilation
          regulation of blood vessel size
          regulation of nitric-oxide synthase activity
          negative regulation of hydrolase activity
          negative regulation of calcium ion transport
          oxidation-reduction process
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          actin monomer binding
          nitric-oxide synthase activity
          iron ion binding
          protein binding
          calmodulin binding
          FMN binding
          heme binding
          tetrahydrobiopterin binding
          arginine binding
          cadmium ion binding
          flavin adenine dinucleotide binding
          NADP binding
          scaffold protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-659f68c6f4-2k58s:80/100.66.76.192:80.
          git-commit: 208ebf2ce40f07c29af7b8d1bec64c518c8c0cf8
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.43.0-2026.01.05-1.0