Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__25746809_50
          See other ARVCF GT Assays ›
          SNP ID:
          rs4680
          Gene
          ARVCF COMT MIR4761
          Gene Name
          armadillo repeat gene deleted in velocardiofacial syndrome
          catechol-O-methyltransferase
          microRNA 4761
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.22: 19963748 - 19963748 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CCAGCGGATGGTGGATTTCGCTGGC[A/G]TGAAGGACAAGGTGTGCATGCCTGA

          Assay ID C__25746809_50
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602269 MIM: 116790

          Literature Links:

          ARVCF PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.37)
          (0.63)
          Caucasian
          A (0.43)
          (0.57)
          CEPH (CEU)
          A (0.48)
          (0.52)
          EAS
          A (0.28)
          (0.72)
          African American
          A (0.26)
          (0.74)
          YRI (Yoruba)
          A (0.31)
          (0.69)
          SAS
          A (0.44)
          (0.56)
          Japanese
          A (0.37)
          (0.63)
          JPT (Japanese)
          A (0.29)
          (0.71)
          AFR
          A (0.28)
          (0.72)
          Chinese
          A (0.31)
          (0.69)
          CHB (Han Chinese)
          A (0.26)
          (0.74)
          EUR
          G (0.50)
          (0.50)
          AMR
          A (0.38)
          (0.62)
          ARVCF - armadillo repeat gene deleted in velocardiofacial syndrome
          There are no transcripts associated with this gene.
          COMT - catechol-O-methyltransferase
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000754.3 696 Missense Mutation ATG,GTG M,V 158 NP_000745.1
          NM_001135161.1 696 Missense Mutation ATG,GTG M,V 158 NP_001128633.1
          NM_001135162.1 696 Missense Mutation ATG,GTG M,V 158 NP_001128634.1
          NM_007310.2 696 Missense Mutation ATG,GTG M,V 108 NP_009294.1
          XM_011529886.1 696 Missense Mutation ATG,GTG M,V 196 XP_011528188.1
          XM_017028594.1 696 Missense Mutation ATG,GTG M,V 158 XP_016884083.1
          XM_017028595.1 696 Missense Mutation ATG,GTG M,V 158 XP_016884084.1
          MIR4761 - microRNA 4761
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          methyltransferase

          Gene Ontology Categories:

          Function(s) Process(es)

          female pregnancy
          learning
          short-term memory
          estrogen metabolic process
          response to organic cyclic compound
          cellular response to phosphate starvation
          methylation
          response to lipopolysaccharide
          developmental process
          negative regulation of renal sodium excretion
          neurotransmitter catabolic process
          dopamine catabolic process
          response to drug
          negative regulation of dopamine metabolic process
          response to pain
          multicellular organismal reproductive process
          negative regulation of smooth muscle cell proliferation
          positive regulation of homocysteine metabolic process
          regulation of sensory perception of pain
          magnesium ion binding
          protein binding
          methyltransferase activity
          O-methyltransferase activity
          catechol O-methyltransferase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-ctdjb:80/100.66.76.55:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0