Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__25746809_50
          See other ARVCF GT Assays ›
          SNP ID:
          rs4680
          Gene
          ARVCF COMT MIR4761
          Gene Name
          armadillo repeat gene deleted in velocardiofacial syndrome
          catechol-O-methyltransferase
          microRNA 4761
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.22: 19963748 - 19963748 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CCAGCGGATGGTGGATTTCGCTGGC[A/G]TGAAGGACAAGGTGTGCATGCCTGA

          Assay ID C__25746809_50
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602269 MIM: 116790

          Literature Links:

          ARVCF PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.37)
          (0.63)
          Caucasian
          A (0.43)
          (0.57)
          CEPH (CEU)
          A (0.48)
          (0.52)
          EAS
          A (0.28)
          (0.72)
          African American
          A (0.26)
          (0.74)
          YRI (Yoruba)
          A (0.31)
          (0.69)
          SAS
          A (0.44)
          (0.56)
          Japanese
          A (0.37)
          (0.63)
          JPT (Japanese)
          A (0.29)
          (0.71)
          AFR
          A (0.28)
          (0.72)
          Chinese
          A (0.31)
          (0.69)
          CHB (Han Chinese)
          A (0.26)
          (0.74)
          EUR
          G (0.50)
          (0.50)
          AMR
          A (0.38)
          (0.62)
          ARVCF - armadillo repeat gene deleted in velocardiofacial syndrome
          There are no transcripts associated with this gene.
          COMT - catechol-O-methyltransferase
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000754.3 696 Missense Mutation ATG,GTG M,V 158 NP_000745.1
          NM_001135161.1 696 Missense Mutation ATG,GTG M,V 158 NP_001128633.1
          NM_001135162.1 696 Missense Mutation ATG,GTG M,V 158 NP_001128634.1
          NM_007310.2 696 Missense Mutation ATG,GTG M,V 108 NP_009294.1
          XM_011529886.1 696 Missense Mutation ATG,GTG M,V 196 XP_011528188.1
          XM_017028594.1 696 Missense Mutation ATG,GTG M,V 158 XP_016884083.1
          XM_017028595.1 696 Missense Mutation ATG,GTG M,V 158 XP_016884084.1
          MIR4761 - microRNA 4761
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          methyltransferase

          Gene Ontology Categories:

          Function(s) Process(es)

          female pregnancy
          learning
          short-term memory
          estrogen metabolic process
          response to organic cyclic compound
          cellular response to phosphate starvation
          methylation
          response to lipopolysaccharide
          developmental process
          negative regulation of renal sodium excretion
          neurotransmitter catabolic process
          dopamine catabolic process
          response to drug
          negative regulation of dopamine metabolic process
          response to pain
          multicellular organismal reproductive process
          negative regulation of smooth muscle cell proliferation
          positive regulation of homocysteine metabolic process
          regulation of sensory perception of pain
          magnesium ion binding
          protein binding
          methyltransferase activity
          O-methyltransferase activity
          catechol O-methyltransferase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-6wvps:80/100.66.75.98:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0