Search
LOADING 
- SNP ID:
- rs145439991
- Gene
-
CDHR4IP6K1 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.3: 49791430 - 49791430 on Build GRCh38
- Polymorphism:
- C/G, Transversion substitution
- Context Sequence [VIC/FAM]:
CCAGGCAGAGAATAGCTTAGGAAGA[C/G]GGGGACTCACGGGAGTCCTGTGCTC
Genomic Map
Back To TopAssay Details
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 606991
|
|||||||||||||||||||||||
Literature Links: |
CDHR4 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | |||
|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
| EUR - Not Available | |||||
| AMR - Not Available |
| CDHR4 - cadherin related family member 4 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001007540.3 | Intron | NP_001007541.2 | ||||
| XM_011533700.2 | Intron | XP_011532002.1 | ||||
| XM_011533701.2 | Intron | XP_011532003.1 | ||||
| XM_017006366.1 | Intron | XP_016861855.1 | ||||
| XM_017006367.1 | Intron | XP_016861856.1 | ||||
| XM_017006368.1 | Intron | XP_016861857.1 | ||||
| XM_017006369.1 | Intron | XP_016861858.1 | ||||
| XM_017006370.1 | Intron | XP_016861859.1 | ||||
| XM_017006371.1 | Intron | XP_016861860.1 | ||||
| IP6K1 - inositol hexakisphosphate kinase 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top