Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__25928034_20
          See other RGN GT Assays ›
          SNP ID:
          rs148051057
          Gene
          RGN
          Gene Name
          regucalcin
          Set Membership:
          -
          Chromosome Location:
          Chr.X: 47084555 - 47084555 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GGTGGATAACGACAAGAAAAACAAT[C/T]GCTTCAATGATGGGAAGGTGGATCC

          Assay ID C__25928034_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 300212

          Literature Links:

          RGN PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.01)
          (0.99)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.02)
          (0.98)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          RGN - regucalcin
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001282848.1 1291 Missense Mutation CGC,TGC R,C 48 NP_001269777.1
          NM_001282849.1 1291 Missense Mutation CGC,TGC R,C 101 NP_001269778.1
          NM_004683.5 1291 Missense Mutation CGC,TGC R,C 101 NP_004674.1
          NM_152869.3 1291 Missense Mutation CGC,TGC R,C 101 NP_690608.1
          XM_006724567.2 1291 Missense Mutation CGC,TGC R,C 101 XP_006724630.1
          XM_006724568.2 1291 Missense Mutation CGC,TGC R,C 101 XP_006724631.1
          XM_017029954.1 1291 Missense Mutation CGC,TGC R,C 101 XP_016885443.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          esterase

          Gene Ontology Categories:

          Function(s) Process(es)

          kidney development
          negative regulation of protein kinase activity
          cellular calcium ion homeostasis
          spermatogenesis
          aging
          positive regulation of triglyceride biosynthetic process
          positive regulation of glucose metabolic process
          positive regulation of phosphatase activity
          L-ascorbic acid biosynthetic process
          negative regulation of phosphoprotein phosphatase activity
          positive regulation of ATPase activity
          negative regulation of GTPase activity
          negative regulation of apoptotic process
          positive regulation of GTPase activity
          negative regulation of nitric oxide biosynthetic process
          positive regulation of fatty acid biosynthetic process
          negative regulation of epithelial cell proliferation
          regulation of calcium-mediated signaling
          negative regulation of cyclic-nucleotide phosphodiesterase activity
          liver regeneration
          negative regulation of sperm motility
          positive regulation of superoxide dismutase activity
          positive regulation of calcium-transporting ATPase activity
          negative regulation of RNA biosynthetic process
          negative regulation of bone development
          positive regulation of proteolysis involved in cellular protein catabolic process
          negative regulation of calcium-dependent ATPase activity
          negative regulation of DNA catabolic process
          positive regulation of dUTP diphosphatase activity
          negative regulation of leucine-tRNA ligase activity
          negative regulation of DNA biosynthetic process
          gluconolactonase activity
          calcium ion binding
          zinc ion binding
          enzyme regulator activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-9fm2r:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline