Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • New Products
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__26426077_10
          See other ADIPOQ GT Assays ›
          SNP ID:
          rs2241766
          Gene
          ADIPOQ ADIPOQ-AS1
          Gene Name
          adiponectin, C1Q and collagen domain containing
          ADIPOQ antisense RNA 1
          Set Membership:
          -
          Chromosome Location:
          Chr.3: 186853103 - 186853103 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          TTCTACTGCTATTAGCTCTGCCCGG[G/T]CATGACCAGGAAACCACGACTCAAG

          Assay ID C__26426077_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605441

          Literature Links:

          ADIPOQ PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.15)
          (0.85)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.30)
          (0.70)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.15)
          (0.85)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.04)
          (0.96)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.13)
          (0.87)
          AMR
          G (0.19)
          (0.81)
          ADIPOQ - adiponectin, C1Q and collagen domain containing
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001177800.1 129 Silent Mutation GGG,GGT G,G 15 NP_001171271.1
          NM_004797.3 129 Silent Mutation GGG,GGT G,G 15 NP_004788.1
          ADIPOQ-AS1 - ADIPOQ antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          response to hypoxia
          positive regulation of protein phosphorylation
          glucose metabolic process
          generation of precursor metabolites and energy
          fatty acid beta-oxidation
          response to nutrient
          circadian rhythm
          response to sucrose
          response to glucose
          positive regulation of signal transduction
          negative regulation of platelet-derived growth factor receptor signaling pathway
          positive regulation of protein kinase A signaling
          negative regulation of macrophage derived foam cell differentiation
          negative regulation of tumor necrosis factor-mediated signaling pathway
          positive regulation of cholesterol efflux
          regulation of glucose metabolic process
          response to activity
          negative regulation of smooth muscle cell migration
          fatty acid oxidation
          negative regulation of cell migration
          negative regulation of granulocyte differentiation
          negative regulation of protein autophosphorylation
          positive regulation of cellular protein metabolic process
          negative regulation of tumor necrosis factor production
          positive regulation of interleukin-8 production
          cellular response to insulin stimulus
          positive regulation of myeloid cell apoptotic process
          adiponectin-activated signaling pathway
          negative regulation of heterotypic cell-cell adhesion
          low-density lipoprotein particle clearance
          response to tumor necrosis factor
          cellular response to drug
          glucose homeostasis
          positive regulation of I-kappaB kinase/NF-kappaB signaling
          negative regulation of I-kappaB kinase/NF-kappaB signaling
          negative regulation of MAP kinase activity
          response to ethanol
          negative regulation of fat cell differentiation
          negative regulation of macrophage differentiation
          negative regulation of low-density lipoprotein particle receptor biosynthetic process
          negative regulation of gluconeogenesis
          negative regulation of blood pressure
          positive regulation of blood pressure
          negative regulation of transcription, DNA-templated
          positive regulation of fatty acid metabolic process
          positive regulation of glucose import
          negative regulation of hormone secretion
          negative regulation of smooth muscle cell proliferation
          negative regulation of inflammatory response
          positive regulation of peptidyl-tyrosine phosphorylation
          negative regulation of phagocytosis
          negative regulation of synaptic transmission
          brown fat cell differentiation
          protein homooligomerization
          response to glucocorticoid
          membrane depolarization
          membrane hyperpolarization
          protein heterotrimerization
          negative regulation of ERK1 and ERK2 cascade
          response to linoleic acid
          detection of oxidative stress
          cellular response to cAMP
          positive regulation of monocyte chemotactic protein-1 production
          cellular response to epinephrine stimulus
          protein localization to plasma membrane
          negative regulation of intracellular protein transport
          negative regulation of receptor binding
          negative regulation of DNA biosynthetic process
          positive regulation of glycogen (starch) synthase activity
          positive regulation of metanephric glomerular visceral epithelial cell development
          positive regulation of cAMP-dependent protein kinase activity
          positive regulation of renal albumin absorption
          negative regulation of platelet-derived growth factor receptor-alpha signaling pathway
          negative regulation of metanephric mesenchymal cell migration
          receptor binding
          cytokine activity
          hormone activity
          protein binding
          sialic acid binding
          identical protein binding
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-7fb9f846c9-xq5gc:80/100.66.76.64:80.
          git-commit: 8207b5afa5c305bd40e0a4f0b9b53fd46f2a8829
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.59.1-2026.09.91-1.0