Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__27102414_10
          See other CYP2D6 GT Assays ›
          SNP ID:
          rs1135840
          Gene
          CYP2D6 LOC102723722 NDUFA6-AS1
          Gene Name
          cytochrome P450 family 2 subfamily D member 6
          uncharacterized LOC102723722
          NDUFA6 antisense RNA 1 (head to head)
          Set Membership:
          > DME > Validated > Inventoried
          Chromosome Location:
          Chr.22: 42126611 - 42126611 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          AGCACAAAGCTCATAGGGGGATGGG[C/G]TCACCAGGAAAGCAAAGACACCATG

          Assay ID C__27102414_10
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 124030

          Literature Links:

          CYP2D6 PubMed Links

          Allele Nomenclature:

          CYP2D6*10A,g.4180G>C CYP2D6*10B,g.4180G>C CYP2D6*10D,g.4180G>C CYP2D6*11,g.4180G>C CYP2D6*12,g.4180G>C CYP2D6*14A,g.4180G>C CYP2D6*14B,g.4180G>C CYP2D6*17,g.4180G>C CYP2D6*19,g.4180G>C CYP2D6*20,g.4180G>C CYP2D6*21A,g.4180G>C CYP2D6*21B,g.4180G>C CYP2D6*28,g.4180G>C CYP2D6*29,g.4180G>C CYP2D6*2A,g.4180G>C CYP2D6*2B,g.4180G>C CYP2D6*2C,g.4180G>C CYP2D6*2D,g.4180G>C CYP2D6*2E,g.4180G>C CYP2D6*2F,g.4180G>C CYP2D6*2G,g.4180G>C CYP2D6*2H,g.4180G>C CYP2D6*2J,g.4180G>C CYP2D6*2K,g.4180G>C CYP2D6*2L,g.4180G>C CYP2D6*2M,g.4180G>C CYP2D6*2X13,g.4180G>C CYP2D6*2X2,g.4180G>C CYP2D6*2X3,g.4180G>C CYP2D6*2X4,g.4180G>C CYP2D6*2X5,g.4180G>C CYP2D6*2XN,g.4180G>C CYP2D6*30,g.4180G>C CYP2D6*31,g.4180G>C CYP2D6*32,g.4180G>C CYP2D6*35,g.4180G>C CYP2D6*35X2,g.4180G>C CYP2D6*36 Dupl. or tandem,g.4180G>C CYP2D6*36 Single,g.4180G>C CYP2D6*36,g.4180G>C CYP2D6*37,g.4180G>C CYP2D6*39,g.4180G>C CYP2D6*40,g.4180G>C CYP2D6*41,g.4180G>C CYP2D6*41A,g.4180G>C CYP2D6*41B,g.4180G>C CYP2D6*42,g.4180G>C CYP2D6*45A,g.4180G>C CYP2D6*45B,g.4180G>C CYP2D6*46,g.4180G>C CYP2D6*47,g.4180G>C CYP2D6*49,g.4180G>C CYP2D6*4A,g.4180G>C CYP2D6*4B,g.4180G>C CYP2D6*4C,g.4180G>C CYP2D6*4D,g.4180G>C CYP2D6*4E,g.4180G>C CYP2D6*4F,g.4180G>C CYP2D6*4G,g.4180G>C CYP2D6*4H,g.4180G>C CYP2D6*4K,g.4180G>C CYP2D6*4L,g.4180G>C CYP2D6*4N,g.4180G>C CYP2D6*51,g.4180G>C CYP2D6*52,g.4180G>C CYP2D6*54,g.4180G>C CYP2D6*55,g.4180G>C CYP2D6*56A,g.4180G>C CYP2D6*56B,g.4180G>C CYP2D6*57,g.4180G>C CYP2D6*58,g.4180G>C CYP2D6*59,g.4180G>C CYP2D6*6C,g.4180G>C CYP2D6*8,g.4180G>C

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.40)
          (0.60)
          Caucasian
          C (0.46)
          (0.54)
          CEPH (CEU) - Not Available
          EAS
          G (0.30)
          (0.70)
          African American
          C (0.39)
          (0.61)
          YRI (Yoruba) - Not Available
          SAS
          G (0.47)
          (0.53)
          Japanese
          C (0.41)
          (0.59)
          CHB (Han Chinese) - Not Available
          AFR
          G (0.32)
          (0.68)
          Chinese
          C (0.21)
          (0.79)
          JPT (Japanese) - Not Available
          EUR
          G (0.45)
          (0.55)
          AMR
          C (0.48)
          (0.52)
          CYP2D6 - cytochrome P450 family 2 subfamily D member 6
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000106.5 1394 Missense Mutation ACC,AGC T,S 486 NP_000097.3
          NM_001025161.2 1394 Missense Mutation ACC,AGC T,S 435 NP_001020332.2
          XM_011529966.2 1394 Intron XP_011528268.1
          XM_011529968.2 1394 Intron XP_011528270.1
          XM_011529970.2 1394 Intron XP_011528272.1
          XM_011529972.2 1394 Intron XP_011528274.1
          LOC102723722 - uncharacterized LOC102723722
          There are no transcripts associated with this gene.
          NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head)
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Important Information

          Note that C__27102414_10 will not amplify the 4180G>C rs1135840 SNP region in CYP26*36 and other alleles that carry a gene conversion to CYP2D7 in exon 9.

          Additional Information:

          The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.

          Set Membership:

          DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          oxidoreductase oxygenase metabolite interconversion enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          xenobiotic metabolic process
          steroid metabolic process
          coumarin metabolic process
          alkaloid metabolic process
          alkaloid catabolic process
          monoterpenoid metabolic process
          drug metabolic process
          arachidonic acid metabolic process
          isoquinoline alkaloid metabolic process
          drug catabolic process
          heterocycle metabolic process
          negative regulation of binding
          oxidation-reduction process
          oxidative demethylation
          negative regulation of cellular organofluorine metabolic process
          monooxygenase activity
          iron ion binding
          drug binding
          arachidonic acid epoxygenase activity
          steroid hydroxylase activity
          oxidoreductase activity
          oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
          oxygen binding
          heme binding
          aromatase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-b27fw:80/100.66.78.82:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0