Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__32407243_20
          See other CYP2D6 GT Assays ›
          SNP ID:
          rs5030655
          Gene
          CYP2D6 LOC102723722 NDUFA6-AS1
          Gene Name
          cytochrome P450 family 2 subfamily D member 6
          uncharacterized LOC102723722
          NDUFA6 antisense RNA 1 (head to head)
          Set Membership:
          > DME > Validated > Inventoried
          Chromosome Location:
          Chr.22: 42129084 - 42129084 on Build GRCh38
          Polymorphism:
          A/-, Insertion/deletion
          Context Sequence [VIC/FAM]:

          AGGCAGGCGGCCTCCTCGGTCACCC[A/-]CTGCTCCAGCGACTTCTTGCCCAGG

          Assay ID C__32407243_20
          Size VIC-FAM | 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 124030

          Literature Links:

          CYP2D6 PubMed Links

          Allele Nomenclature:

          CYP2D6*6A,g.1707T>del CYP2D6*6A,g.1707delT CYP2D6*6B,g.1707T>del CYP2D6*6B,g.1707delT CYP2D6*6C,g.1707T>del CYP2D6*6C,g.1707delT CYP2D6*6D,g.1707T>del CYP2D6*6D,g.1707delT CYP2D6,g.1707T>G/C/A

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          - (0.00)
          (1.00)
          Caucasian
          - (0.00)
          (1.00)
          CEPH (CEU) - Not Available
          EAS
          - (0.00)
          (1.00)
          African American
          - (0.00)
          (1.00)
          YRI (Yoruba) - Not Available
          SAS
          - (0.00)
          (1.00)
          Japanese
          - (0.00)
          (1.00)
          CHB (Han Chinese) - Not Available
          AFR
          - (0.00)
          (1.00)
          Chinese
          - (0.00)
          (1.00)
          JPT (Japanese) - Not Available
          EUR
          - (0.02)
          (0.98)
          AMR
          - (0.00)
          (1.00)
          CYP2D6 - cytochrome P450 family 2 subfamily D member 6
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000106.5 544 Frame Shift Delete GGG,TGG G,W 152 NP_000097.3
          NM_001025161.2 544 Intron NP_001020332.2
          XM_011529966.2 544 Intron XP_011528268.1
          XM_011529968.2 544 Intron XP_011528270.1
          XM_011529970.2 544 Intron XP_011528272.1
          XM_011529972.2 544 Intron XP_011528274.1
          LOC102723722 - uncharacterized LOC102723722
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          XM_017029174.1 544 Intron XP_016884663.1
          NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head)
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Additional Information:

          The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.

          Set Membership:

          DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          oxidoreductase oxygenase metabolite interconversion enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          xenobiotic metabolic process
          steroid metabolic process
          coumarin metabolic process
          alkaloid metabolic process
          alkaloid catabolic process
          monoterpenoid metabolic process
          drug metabolic process
          arachidonic acid metabolic process
          isoquinoline alkaloid metabolic process
          drug catabolic process
          heterocycle metabolic process
          negative regulation of binding
          oxidation-reduction process
          oxidative demethylation
          negative regulation of cellular organofluorine metabolic process
          monooxygenase activity
          iron ion binding
          drug binding
          arachidonic acid epoxygenase activity
          steroid hydroxylase activity
          oxidoreductase activity
          oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
          oxygen binding
          heme binding
          aromatase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-lnstr:80/100.66.74.145:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline