Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__33582517_10
          See other BCAS3 GT Assays ›
          SNP ID:
          rs16969217
          Gene
          BCAS3
          Gene Name
          BCAS3, microtubule associated cell migration factor
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.17: 60687038 - 60687038 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TACACTATGGAAATTATTTTCTCTA[C/T]AGTGAGCAAATAAGACAACATACAG

          Assay ID C__33582517_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 607470

          Literature Links:

          BCAS3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.19)
          (0.81)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.11)
          (0.89)
          African American - Not Available YRI (Yoruba)
          C (0.45)
          (0.55)
          SAS
          C (0.06)
          (0.94)
          Chinese - Not Available JPT (Japanese)
          C (0.12)
          (0.88)
          AFR
          T (0.46)
          (0.54)
          Japanese - Not Available CHB (Han Chinese)
          C (0.15)
          (0.85)
          EUR
          C (0.01)
          (0.99)
          AMR
          C (0.05)
          (0.95)
          BCAS3 - BCAS3, microtubule associated cell migration factor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001099432.1 Intron NP_001092902.1
          NM_001320470.1 Intron NP_001307399.1
          NM_017679.3 Intron NP_060149.3
          XM_005257472.1 Intron XP_005257529.1
          XM_011524939.1 Intron XP_011523241.1
          XM_011524940.1 Intron XP_011523242.1
          XM_011524941.1 Intron XP_011523243.1
          XM_011524942.2 Intron XP_011523244.1
          XM_011524943.2 Intron XP_011523245.1
          XM_011524944.1 Intron XP_011523246.1
          XM_011524945.2 Intron XP_011523247.1
          XM_011524946.2 Intron XP_011523248.1
          XM_011524947.1 Intron XP_011523249.1
          XM_011524948.2 Intron XP_011523250.1
          XM_011524949.2 Intron XP_011523251.1
          XM_011524950.1 Intron XP_011523252.1
          XM_011524951.2 Intron XP_011523253.1
          XM_017024783.1 Intron XP_016880272.1
          XM_017024784.1 Intron XP_016880273.1
          XM_017024785.1 Intron XP_016880274.1
          XM_017024786.1 Intron XP_016880275.1
          XM_017024787.1 Intron XP_016880276.1
          XM_017024788.1 Intron XP_016880277.1
          XM_017024789.1 Intron XP_016880278.1
          XM_017024790.1 Intron XP_016880279.1
          XM_017024791.1 Intron XP_016880280.1
          XM_017024792.1 Intron XP_016880281.1
          XM_017024793.1 Intron XP_016880282.1
          XM_017024794.1 Intron XP_016880283.1
          XM_017024795.1 Intron XP_016880284.1
          XM_017024796.1 Intron XP_016880285.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          angiogenesis
          transcription, DNA-templated
          Golgi organization
          positive regulation of endothelial cell migration
          vesicle-mediated transport
          microtubule organizing center organization
          negative regulation of GTPase activity
          tube formation
          response to starvation
          positive regulation of catalytic activity
          positive regulation of GTPase activity
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of filopodium assembly
          negative regulation of focal adhesion assembly
          cellular response to estrogen stimulus
          positive regulation of intracellular protein transport
          activation of GTPase activity
          regulation of establishment of cell polarity
          positive regulation of actin cytoskeleton reorganization
          chromatin binding
          protein binding
          transcription factor binding
          acetyltransferase activator activity
          histone acetyltransferase binding
          nuclear hormone receptor binding
          histone binding
          beta-tubulin binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline