Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__33817524_10
          See other AHRR GT Assays ›
          SNP ID:
          rs16900804
          Gene
          AHRR PDCD6
          Gene Name
          aryl-hydrocarbon receptor repressor
          programmed cell death 6
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.5: 305480 - 305480 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GATGGAGGGAGAGAAAACTTGGAAG[C/T]GTAGTAGTGGCAGGGCTCAGCCTTT

          Assay ID C__33817524_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 606517 MIM: 601057

          Literature Links:

          AHRR PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.11)
          (0.89)
          Caucasian - Not Available CEPH (CEU)
          C (0.21)
          (0.79)
          EAS
          C (0.05)
          (0.95)
          African American - Not Available YRI (Yoruba)
          C (0.06)
          (0.94)
          SAS
          C (0.12)
          (0.88)
          Chinese - Not Available JPT (Japanese)
          C (0.01)
          (0.99)
          AFR
          C (0.08)
          (0.92)
          Japanese - Not Available CHB (Han Chinese)
          C (0.02)
          (0.98)
          EUR
          C (0.19)
          (0.81)
          AMR
          C (0.16)
          (0.84)
          AHRR - aryl-hydrocarbon receptor repressor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001242412.1 Intron NP_001229341.1
          NM_020731.4 Intron NP_065782.2
          PDCD6 - programmed cell death 6
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001267556.1 Intron NP_001254485.1
          NM_001267557.1 Intron NP_001254486.1
          NM_001267558.1 Intron NP_001254487.1
          NM_001267559.1 Intron NP_001254488.1
          NM_013232.3 Intron NP_037364.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          basic helix-loop-helix transcription factor actin or actin-binding cytoskeletal protein

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          transcription, DNA-templated
          response to xenobiotic stimulus
          positive regulation of transcription from RNA polymerase II promoter
          angiogenesis
          positive regulation of endothelial cell proliferation
          proteolysis
          intracellular protein transport
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          positive regulation of endothelial cell migration
          negative regulation of vascular endothelial growth factor receptor signaling pathway
          negative regulation of TOR signaling
          cellular response to heat
          vascular endothelial growth factor receptor-2 signaling pathway
          positive regulation of cysteine-type endopeptidase activity involved in apoptotic process
          positive regulation of angiogenesis
          response to calcium ion
          negative regulation of protein kinase B signaling
          apoptotic signaling pathway
          transcriptional repressor activity, RNA polymerase II transcription factor binding
          DNA binding
          protein dimerization activity
          calcium-dependent cysteine-type endopeptidase activity
          calcium ion binding
          protein binding
          identical protein binding
          protein homodimerization activity
          protein anchor
          calcium-dependent protein binding
          binding, bridging

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline