Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2403545_10
          See other TP53 GT Assays ›
          SNP ID:
          rs1042522
          Gene
          TP53 WRAP53
          Gene Name
          tumor protein p53
          WD repeat containing antisense to TP53
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.17: 7676154 - 7676154 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          AGGAGCTGCTGGTGCAGGGGCCACG[C/G]GGGGAGCAGCCTCTGGCATTCTGGG

          Assay ID C___2403545_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 191170 MIM: 612661

          Literature Links:

          TP53 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.46)
          (0.54)
          Caucasian - Not Available CEPH (CEU)
          C (0.23)
          (0.77)
          EAS
          G (0.41)
          (0.59)
          African American - Not Available YRI (Yoruba)
          G (0.33)
          (0.67)
          SAS
          G (0.49)
          (0.51)
          Chinese - Not Available JPT (Japanese)
          C (0.41)
          (0.59)
          AFR
          C (0.33)
          (0.67)
          Japanese - Not Available CHB (Han Chinese)
          G (0.49)
          (0.51)
          EUR
          G (0.29)
          (0.71)
          AMR
          C (0.32)
          (0.68)
          TP53 - tumor protein p53
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000546.5 417 Missense Mutation CCC,CGC P,R 72 NP_000537.3
          NM_001126112.2 417 Missense Mutation CCC,CGC P,R 72 NP_001119584.1
          NM_001126113.2 417 Missense Mutation CCC,CGC P,R 72 NP_001119585.1
          NM_001126114.2 417 Missense Mutation CCC,CGC P,R 72 NP_001119586.1
          NM_001126115.1 417 Intron NP_001119587.1
          NM_001126116.1 417 Intron NP_001119588.1
          NM_001126117.1 417 Intron NP_001119589.1
          NM_001126118.1 417 Missense Mutation CCC,CGC P,R 33 NP_001119590.1
          NM_001276695.1 417 Missense Mutation CCC,CGC P,R 33 NP_001263624.1
          NM_001276696.1 417 Missense Mutation CCC,CGC P,R 33 NP_001263625.1
          NM_001276697.1 417 Intron NP_001263626.1
          NM_001276698.1 417 Intron NP_001263627.1
          NM_001276699.1 417 Intron NP_001263628.1
          NM_001276760.1 417 Missense Mutation CCC,CGC P,R 33 NP_001263689.1
          NM_001276761.1 417 Missense Mutation CCC,CGC P,R 33 NP_001263690.1
          WRAP53 - WD repeat containing antisense to TP53
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          P53-like transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          DNA strand renaturation
          base-excision repair
          nucleotide-excision repair
          regulation of transcription, DNA-templated
          transcription from RNA polymerase II promoter
          protein complex assembly
          cellular response to DNA damage stimulus
          DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest
          DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator
          ER overload response
          cell cycle arrest
          Ras protein signal transduction
          multicellular organism development
          cell aging
          protein localization
          cell proliferation
          negative regulation of cell proliferation
          determination of adult lifespan
          response to X-ray
          response to gamma radiation
          positive regulation of gene expression
          viral process
          protein sumoylation
          cell differentiation
          negative regulation of cell growth
          DNA damage response, signal transduction by p53 class mediator
          positive regulation of histone deacetylation
          chromatin assembly
          mitotic G1 DNA damage checkpoint
          positive regulation of protein oligomerization
          cellular response to UV
          cellular response to drug
          cellular response to glucose starvation
          intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator
          regulation of apoptotic process
          positive regulation of apoptotic process
          negative regulation of apoptotic process
          entrainment of circadian clock by photoperiod
          proteasome-mediated ubiquitin-dependent protein catabolic process
          positive regulation of neuron apoptotic process
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          response to antibiotic
          positive regulation of protein export from nucleus
          regulation of mitochondrial membrane permeability
          negative regulation of fibroblast proliferation
          circadian behavior
          positive regulation of peptidyl-tyrosine phosphorylation
          negative regulation of helicase activity
          protein tetramerization
          negative regulation of telomerase activity
          positive regulation of thymocyte apoptotic process
          positive regulation of cell cycle arrest
          cellular response to hypoxia
          cellular response to ionizing radiation
          intrinsic apoptotic signaling pathway by p53 class mediator
          positive regulation of release of cytochrome c from mitochondria
          replicative senescence
          oxidative stress-induced premature senescence
          intrinsic apoptotic signaling pathway
          oligodendrocyte apoptotic process
          positive regulation of execution phase of apoptosis
          positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway
          regulation of signal transduction by p53 class mediator
          regulation of cell cycle G2/M phase transition
          positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress
          positive regulation of reactive oxygen species metabolic process
          positive regulation of intrinsic apoptotic signaling pathway
          RNA polymerase II transcription factor activity, sequence-specific DNA binding
          core promoter sequence-specific DNA binding
          RNA polymerase II transcription factor binding
          transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding
          protease binding
          p53 binding
          DNA binding
          chromatin binding
          damaged DNA binding
          double-stranded DNA binding
          transcription factor activity, sequence-specific DNA binding
          copper ion binding
          protein binding
          ATP binding
          transcription factor binding
          zinc ion binding
          enzyme binding
          protein kinase binding
          protein phosphatase binding
          receptor tyrosine kinase binding
          ubiquitin protein ligase binding
          histone acetyltransferase binding
          identical protein binding
          sequence-specific DNA binding
          protein self-association
          transcription regulatory region DNA binding
          protein heterodimerization activity
          protein N-terminus binding
          chaperone binding
          protein phosphatase 2A binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fkn7b:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline