Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2469817_10
          See other NADK GT Assays ›
          SNP ID:
          rs7407
          Gene
          NADK SLC35E2
          Gene Name
          NAD kinase
          solute carrier family 35 member E2
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.1: 1753033 - 1753033 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          GGTCCCGCACACAGATGGAGGGGAG[T/C]GGGTAGCATGAGGTAGTGATGCTGA

          Assay ID C___2469817_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          60 submissions

          Phenotype:

          MIM: 611616

          Literature Links:

          NADK PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.34)
          (0.66)
          Caucasian
          T (0.46)
          (0.54)
          CEPH (CEU)
          A (0.50)
          (0.50)
          EAS
          A (0.35)
          (0.65)
          African American
          T (0.10)
          (0.90)
          YRI (Yoruba)
          A (0.02)
          (0.98)
          SAS
          A (0.39)
          (0.61)
          Japanese
          T (0.37)
          (0.63)
          JPT (Japanese)
          A (0.37)
          (0.63)
          AFR
          A (0.06)
          (0.94)
          Chinese
          T (0.36)
          (0.64)
          CHB (Han Chinese)
          A (0.35)
          (0.65)
          EUR
          G (0.50)
          (0.50)
          AMR
          G (0.44)
          (0.56)
          NADK - NAD kinase
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001198993.1 1138 Silent Mutation CCA,CCG P,P 404 NP_001185922.1
          NM_001198994.1 1138 Silent Mutation CCA,CCG P,P 549 NP_001185923.1
          NM_001198995.1 1138 Silent Mutation CCA,CCG P,P 372 NP_001185924.1
          NM_023018.4 1138 Silent Mutation CCA,CCG P,P 404 NP_075394.3
          XM_005244778.2 1138 Silent Mutation CCA,CCG P,P 404 XP_005244835.1
          XM_006710837.2 1138 Silent Mutation CCA,CCG P,P 404 XP_006710900.1
          XM_006710838.2 1138 Silent Mutation CCA,CCG P,P 317 XP_006710901.1
          XM_006710839.1 1138 Silent Mutation CCA,CCG P,P 508 XP_006710902.1
          XM_011542006.1 1138 Silent Mutation CCA,CCG P,P 301 XP_011540308.1
          XM_011542007.1 1138 Silent Mutation CCA,CCG P,P 301 XP_011540309.1
          XM_011542008.1 1138 Silent Mutation CCA,CCG P,P 301 XP_011540310.1
          XM_011542009.2 1138 Silent Mutation CCA,CCG P,P 301 XP_011540311.1
          XM_017002143.1 1138 Missense Mutation ACT,GCT T,A 377 XP_016857632.1
          XM_017002144.1 1138 Silent Mutation CCA,CCG P,P 292 XP_016857633.1
          XM_017002145.1 1138 Silent Mutation CCA,CCG P,P 282 XP_016857634.1
          XM_017002146.1 1138 Silent Mutation CCA,CCG P,P 282 XP_016857635.1
          SLC35E2 - solute carrier family 35 member E2
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          nucleotide kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          NADP biosynthetic process
          phosphorylation
          NAD metabolic process
          ATP metabolic process
          NAD+ kinase activity
          protein binding
          ATP binding
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy Consumer Health Data Privacy Policy
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-x75fr:80/100.66.77.4:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline